Incidental Mutation 'R5937:Ano6'
ID462346
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission 043242-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R5937 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95913957 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 241 (I241T)
Ref Sequence ENSEMBL: ENSMUSP00000153853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000226793] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: I241T

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: I241T

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226793
Predicted Effect probably damaging
Transcript: ENSMUST00000227151
AA Change: I241T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: I262T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A T 15: 60,919,646 W314R probably benign Het
Adgrv1 A T 13: 81,107,075 V6143E probably damaging Het
Agap3 C T 5: 24,477,817 T261I probably damaging Het
Arhgef28 T C 13: 97,939,543 T1328A probably benign Het
Capn10 C T 1: 92,939,383 R112W probably damaging Het
Car5a A T 8: 121,939,821 W46R probably damaging Het
Cntn6 C A 6: 104,833,103 T582K possibly damaging Het
Ctsh T C 9: 90,061,456 V60A probably benign Het
Ctsll3 A G 13: 60,799,596 F259L probably damaging Het
Fam228a T C 12: 4,737,725 E16G probably damaging Het
G3bp2 A G 5: 92,055,397 I388T probably damaging Het
Galnt5 A T 2: 58,038,937 K926N probably benign Het
Gm10097 G A 10: 5,069,485 probably benign Het
Gm9978 T A 10: 78,486,841 noncoding transcript Het
Gria1 A G 11: 57,189,733 T112A probably benign Het
Hnrnpk A C 13: 58,395,202 V134G probably damaging Het
Insr A G 8: 3,174,808 V220A probably benign Het
Lhx4 A G 1: 155,710,277 I96T probably damaging Het
Lrp1 T C 10: 127,583,876 T955A possibly damaging Het
Lrtm1 T C 14: 29,021,830 V85A possibly damaging Het
Man2a2 T C 7: 80,363,503 Y514C probably damaging Het
Npas1 T A 7: 16,463,262 D226V probably benign Het
Nrcam G A 12: 44,572,291 V858I probably benign Het
Olfr1462 T A 19: 13,191,311 S215T probably damaging Het
Olfr293 G T 7: 86,664,476 L271F probably benign Het
Pde6b G T 5: 108,424,327 A478S probably benign Het
Pex1 T A 5: 3,624,487 N789K possibly damaging Het
Plekha6 A G 1: 133,260,101 D120G possibly damaging Het
Pomgnt1 A G 4: 116,153,913 T220A probably benign Het
Sdr39u1 A T 14: 55,897,907 I193K probably damaging Het
Sec61a2 C A 2: 5,886,557 M54I probably benign Het
Sema5a A G 15: 32,574,841 Y365C probably damaging Het
Sra1 C T 18: 36,671,599 probably null Het
St5 A T 7: 109,557,271 C91S possibly damaging Het
Taf5 C T 19: 47,081,895 S640L probably damaging Het
Tas2r140 T A 6: 133,055,273 H174L probably benign Het
Tmem63a T A 1: 180,961,151 V351D probably damaging Het
Ttll7 C T 3: 146,944,092 Q626* probably null Het
Ubn2 T A 6: 38,463,982 V263E possibly damaging Het
Vmn2r106 C T 17: 20,285,405 W9* probably null Het
Xrcc3 C G 12: 111,807,972 C141S probably null Het
Zfp516 T A 18: 82,956,833 D385E probably damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4175:Ano6 UTSW 15 95962169 missense probably damaging 1.00
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAACCTATTGCATAGCTGTGG -3'
(R):5'- TCTTGCCCTGGATCAGCTTG -3'

Sequencing Primer
(F):5'- AAACCTATTGCATAGCTGTGGTTTTG -3'
(R):5'- ATCAGCTTGTGATCTTTCATGAC -3'
Posted On2017-02-28