Incidental Mutation 'R0567:AW554918'
Institutional Source Beutler Lab
Gene Symbol AW554918
Ensembl Gene ENSMUSG00000033632
Gene Nameexpressed sequence AW554918
MMRRC Submission 038758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0567 (G1)
Quality Score225
Status Not validated
Chromosomal Location25168999-25467321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25400035 bp
Amino Acid Change Glutamic Acid to Lysine at position 452 (E452K)
Ref Sequence ENSEMBL: ENSMUSP00000046227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036619] [ENSMUST00000097643] [ENSMUST00000100131] [ENSMUST00000159605] [ENSMUST00000160530] [ENSMUST00000165400]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036619
AA Change: E452K

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046227
Gene: ENSMUSG00000033632
AA Change: E452K

Pfam:KIAA1328 92 414 1.4e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097643
AA Change: E485K

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095248
Gene: ENSMUSG00000033632
AA Change: E485K

Pfam:KIAA1328 92 414 2.5e-154 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100131
AA Change: E249K

PolyPhen 2 Score 0.540 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097708
Gene: ENSMUSG00000033632
AA Change: E249K

Pfam:KIAA1328 1 211 9.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159605
Predicted Effect probably benign
Transcript: ENSMUST00000160530
Predicted Effect probably benign
Transcript: ENSMUST00000165400
AA Change: E485K

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128437
Gene: ENSMUSG00000033632
AA Change: E485K

Pfam:KIAA1328 92 414 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,228,016 E303G probably damaging Het
Akr1b3 A T 6: 34,304,345 probably null Het
Alox8 A T 11: 69,191,522 probably null Het
Apcdd1 G A 18: 62,934,036 E74K possibly damaging Het
Atr T C 9: 95,865,829 V388A probably benign Het
C1galt1 A G 6: 7,866,874 D240G probably damaging Het
Ccdc130 A G 8: 84,260,665 L93P probably damaging Het
Ceacam10 T A 7: 24,778,409 D116E probably damaging Het
Col15a1 G T 4: 47,293,231 V912L possibly damaging Het
Cyp3a11 G A 5: 145,869,149 T136I probably damaging Het
Denr C T 5: 123,908,158 T17M probably benign Het
Doc2b A G 11: 75,780,124 F227S probably damaging Het
Dsp A T 13: 38,192,438 T1400S probably benign Het
Egfr A T 11: 16,872,873 D412V probably benign Het
Fryl C T 5: 73,065,391 G1949D possibly damaging Het
Gstp3 A T 19: 4,057,636 L176Q possibly damaging Het
Heatr5a T A 12: 51,910,089 N1075I probably damaging Het
Hist1h2ah T C 13: 22,035,564 probably benign Het
Ighv1-69 C T 12: 115,623,549 probably benign Het
Lama3 A G 18: 12,549,252 I1092V probably benign Het
Lipg A T 18: 74,957,369 H36Q probably benign Het
Myh7b T C 2: 155,626,398 W836R probably damaging Het
Oit3 A T 10: 59,435,978 C186S probably damaging Het
Olfr734 A T 14: 50,320,658 M59K probably damaging Het
P2ry2 T C 7: 100,998,541 T186A probably damaging Het
Pyroxd2 T C 19: 42,735,925 T300A probably benign Het
Rab26 C A 17: 24,529,582 V283F probably damaging Het
Rad50 C T 11: 53,654,956 R1180Q probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Shroom3 A G 5: 92,964,453 D1891G possibly damaging Het
Syne2 G A 12: 75,890,230 E201K probably damaging Het
Taf6 A T 5: 138,183,726 probably null Het
Tbc1d32 A T 10: 56,173,963 M493K possibly damaging Het
Uaca A G 9: 60,871,381 T1017A probably benign Het
Usp17le C T 7: 104,768,898 V346I possibly damaging Het
Vmn1r71 T C 7: 10,748,629 D44G probably damaging Het
Vmn2r80 A G 10: 79,194,831 I830M possibly damaging Het
Zfp994 T C 17: 22,200,468 Y500C possibly damaging Het
Zscan20 A G 4: 128,589,450 probably null Het
Other mutations in AW554918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:AW554918 APN 18 25420065 nonsense probably null
IGL01443:AW554918 APN 18 25344955 missense probably damaging 1.00
IGL01973:AW554918 APN 18 25419999 missense probably damaging 1.00
IGL02743:AW554918 APN 18 25289944 nonsense probably null
PIT4802001:AW554918 UTSW 18 25340075 missense possibly damaging 0.90
R0081:AW554918 UTSW 18 25344902 missense probably benign 0.00
R0709:AW554918 UTSW 18 25463654 missense probably damaging 1.00
R1052:AW554918 UTSW 18 25420010 missense probably benign 0.05
R1418:AW554918 UTSW 18 25339699 splice site probably null
R1530:AW554918 UTSW 18 25400104 missense probably damaging 0.97
R2406:AW554918 UTSW 18 25340287 missense possibly damaging 0.95
R3414:AW554918 UTSW 18 25400072 missense possibly damaging 0.76
R3815:AW554918 UTSW 18 25400047 missense probably benign 0.42
R4683:AW554918 UTSW 18 25339795 missense probably benign 0.04
R4722:AW554918 UTSW 18 25174715 nonsense probably null
R4843:AW554918 UTSW 18 25340000 missense probably benign 0.00
R5199:AW554918 UTSW 18 25340299 missense probably damaging 1.00
R5279:AW554918 UTSW 18 25175431 missense possibly damaging 0.95
R5580:AW554918 UTSW 18 25339865 missense probably damaging 1.00
R7259:AW554918 UTSW 18 25289849 intron probably null
R7388:AW554918 UTSW 18 25340113 missense probably benign 0.05
R7399:AW554918 UTSW 18 25169060 missense possibly damaging 0.67
R8249:AW554918 UTSW 18 25339718 missense probably benign 0.33
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cgagaggcagaggcagag -3'
Posted On2013-06-11