Incidental Mutation 'R5938:Mindy1'
ID 462360
Institutional Source Beutler Lab
Gene Symbol Mindy1
Ensembl Gene ENSMUSG00000038712
Gene Name MINDY lysine 48 deubiquitinase 1
Synonyms 4930504E06Rik, cI-40, NF-E2 inducible protein, 1810005H09Rik, Fam63a
MMRRC Submission 044131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5938 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 95281345-95296166 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95293756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 324 (T324A)
Ref Sequence ENSEMBL: ENSMUSP00000127839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015846] [ENSMUST00000039537] [ENSMUST00000107183] [ENSMUST00000107187] [ENSMUST00000164406] [ENSMUST00000168223]
AlphaFold Q76LS9
Predicted Effect probably benign
Transcript: ENSMUST00000015846
SMART Domains Protein: ENSMUSP00000015846
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039537
AA Change: T324A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043910
Gene: ENSMUSG00000038712
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107183
SMART Domains Protein: ENSMUSP00000102801
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107187
AA Change: T324A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102805
Gene: ENSMUSG00000038712
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 266 7e-42 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 400 406 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135264
Predicted Effect probably benign
Transcript: ENSMUST00000164406
SMART Domains Protein: ENSMUSP00000127424
Gene: ENSMUSG00000015702

DomainStartEndE-ValueType
ANX 58 110 1.48e-17 SMART
ANX 130 182 6.56e-10 SMART
ANX 212 264 1.52e-1 SMART
ANX 287 339 1.03e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168223
AA Change: T324A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127839
Gene: ENSMUSG00000038712
AA Change: T324A

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
low complexity region 67 86 N/A INTRINSIC
Pfam:DUF544 143 268 7.7e-51 PFAM
low complexity region 369 382 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,442,574 D503E possibly damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Cacna1d C T 14: 30,103,735 V1001I probably damaging Het
Calhm3 T C 19: 47,152,077 I192M probably damaging Het
Cep44 A G 8: 56,547,422 S19P possibly damaging Het
Cxcl15 T A 5: 90,801,366 I130K unknown Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Emc1 T G 4: 139,357,620 H167Q probably benign Het
Epb41l3 T G 17: 69,259,071 Y416D probably damaging Het
Erbb2 G A 11: 98,435,571 R1007H probably damaging Het
Esr1 A G 10: 4,966,245 probably benign Het
Fat4 G A 3: 38,951,239 R1929Q probably damaging Het
Fsip2 T A 2: 82,977,491 C1385S probably benign Het
Gbf1 T C 19: 46,268,452 I777T probably damaging Het
Gm13762 T C 2: 88,973,013 M293V probably benign Het
Gm16092 T G 1: 85,512,968 noncoding transcript Het
Gm4951 C A 18: 60,245,652 N86K probably damaging Het
Greb1 T A 12: 16,717,258 K314N probably damaging Het
Ipcef1 A G 10: 6,908,029 probably benign Het
K230010J24Rik G A 15: 76,045,432 E305K possibly damaging Het
Mgat4a C A 1: 37,452,263 L292F probably damaging Het
Mill1 A G 7: 18,262,688 N143S probably benign Het
Mpdz T A 4: 81,284,614 H1882L probably damaging Het
Ncapg2 T A 12: 116,429,657 W494R probably damaging Het
Oas1c A T 5: 120,805,533 H180Q probably benign Het
Olfr1299 A G 2: 111,664,363 M46V probably benign Het
Olfr450 T A 6: 42,817,767 C99S probably damaging Het
Olfr794 A G 10: 129,571,527 R291G probably damaging Het
Olfr988 A T 2: 85,353,276 S217T probably damaging Het
Pelp1 A G 11: 70,394,867 V725A probably damaging Het
Plxna4 T C 6: 32,234,606 E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prdm16 T C 4: 154,347,954 D285G probably damaging Het
Rasa2 A G 9: 96,611,389 S81P possibly damaging Het
Rhd T A 4: 134,895,976 F418Y probably benign Het
Rnf207 T C 4: 152,317,928 probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Ryr1 A C 7: 29,046,865 L3830R probably damaging Het
Sgsh A G 11: 119,346,799 Y330H probably benign Het
Sh3bp5 T C 14: 31,387,834 E130G possibly damaging Het
Slc29a3 A G 10: 60,752,784 probably benign Het
Slco1a5 A G 6: 142,248,717 L400P probably damaging Het
Snd1 A G 6: 28,874,859 probably null Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tas2r110 A T 6: 132,868,053 I16L probably benign Het
Tmx3 T A 18: 90,527,934 V213D possibly damaging Het
Uba2 A T 7: 34,165,490 probably null Het
Wfikkn1 T A 17: 25,878,912 D112V probably damaging Het
Zfhx4 A G 3: 5,402,138 N2452S probably damaging Het
Other mutations in Mindy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Mindy1 APN 3 95288390 missense probably damaging 1.00
IGL03380:Mindy1 APN 3 95291018 splice site probably benign
ANU18:Mindy1 UTSW 3 95288390 missense probably damaging 1.00
PIT4576001:Mindy1 UTSW 3 95288069 missense probably benign 0.12
R4647:Mindy1 UTSW 3 95282743 unclassified probably benign
R5076:Mindy1 UTSW 3 95295399 missense probably benign 0.01
R5875:Mindy1 UTSW 3 95294814 missense probably damaging 0.98
R8112:Mindy1 UTSW 3 95294811 missense probably damaging 1.00
R8692:Mindy1 UTSW 3 95292276 missense probably damaging 1.00
R9356:Mindy1 UTSW 3 95295279 missense probably benign 0.20
R9357:Mindy1 UTSW 3 95295279 missense probably benign 0.20
R9358:Mindy1 UTSW 3 95295279 missense probably benign 0.20
X0028:Mindy1 UTSW 3 95294895 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCCATGTCTCTCCTGG -3'
(R):5'- CTGGTCAGTGTCATTTTCAAGC -3'

Sequencing Primer
(F):5'- AAGCCATGTCTCTCCTGGTTTATG -3'
(R):5'- CCCTGGACATGCATCATGAGTTAG -3'
Posted On 2017-02-28