Incidental Mutation 'R5938:Rhd'
ID462363
Institutional Source Beutler Lab
Gene Symbol Rhd
Ensembl Gene ENSMUSG00000028825
Gene NameRh blood group, D antigen
SynonymsRh, Rhl1, Rhced
MMRRC Submission 044131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5938 (G1)
Quality Score168
Status Validated
Chromosome4
Chromosomal Location134864536-134896172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134895976 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 418 (F418Y)
Ref Sequence ENSEMBL: ENSMUSP00000030627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030626] [ENSMUST00000030627] [ENSMUST00000105863]
Predicted Effect probably benign
Transcript: ENSMUST00000030626
SMART Domains Protein: ENSMUSP00000030626
Gene: ENSMUSG00000028822

DomainStartEndE-ValueType
Pfam:UPF0220 1 157 1.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030627
AA Change: F418Y

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030627
Gene: ENSMUSG00000028825
AA Change: F418Y

DomainStartEndE-ValueType
Pfam:Ammonium_transp 21 400 1.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105863
SMART Domains Protein: ENSMUSP00000101489
Gene: ENSMUSG00000028822

DomainStartEndE-ValueType
Pfam:UPF0220 5 156 2.4e-50 PFAM
Meta Mutation Damage Score 0.1334 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ammonium and methylammonium transport in red cell ghosts, reduced basal adhesion of red blood cells to endothelial cells, and a slight increase in iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,442,574 D503E possibly damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Cacna1d C T 14: 30,103,735 V1001I probably damaging Het
Calhm3 T C 19: 47,152,077 I192M probably damaging Het
Cep44 A G 8: 56,547,422 S19P possibly damaging Het
Cxcl15 T A 5: 90,801,366 I130K unknown Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Emc1 T G 4: 139,357,620 H167Q probably benign Het
Epb41l3 T G 17: 69,259,071 Y416D probably damaging Het
Erbb2 G A 11: 98,435,571 R1007H probably damaging Het
Esr1 A G 10: 4,966,245 probably benign Het
Fat4 G A 3: 38,951,239 R1929Q probably damaging Het
Fsip2 T A 2: 82,977,491 C1385S probably benign Het
Gbf1 T C 19: 46,268,452 I777T probably damaging Het
Gm13762 T C 2: 88,973,013 M293V probably benign Het
Gm16092 T G 1: 85,512,968 noncoding transcript Het
Gm4951 C A 18: 60,245,652 N86K probably damaging Het
Greb1 T A 12: 16,717,258 K314N probably damaging Het
Ipcef1 A G 10: 6,908,029 probably benign Het
K230010J24Rik G A 15: 76,045,432 E305K possibly damaging Het
Mgat4a C A 1: 37,452,263 L292F probably damaging Het
Mill1 A G 7: 18,262,688 N143S probably benign Het
Mindy1 A G 3: 95,293,756 T324A probably benign Het
Mpdz T A 4: 81,284,614 H1882L probably damaging Het
Ncapg2 T A 12: 116,429,657 W494R probably damaging Het
Oas1c A T 5: 120,805,533 H180Q probably benign Het
Olfr1299 A G 2: 111,664,363 M46V probably benign Het
Olfr450 T A 6: 42,817,767 C99S probably damaging Het
Olfr794 A G 10: 129,571,527 R291G probably damaging Het
Olfr988 A T 2: 85,353,276 S217T probably damaging Het
Pelp1 A G 11: 70,394,867 V725A probably damaging Het
Plxna4 T C 6: 32,234,606 E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prdm16 T C 4: 154,347,954 D285G probably damaging Het
Rasa2 A G 9: 96,611,389 S81P possibly damaging Het
Rnf207 T C 4: 152,317,928 probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Ryr1 A C 7: 29,046,865 L3830R probably damaging Het
Sgsh A G 11: 119,346,799 Y330H probably benign Het
Sh3bp5 T C 14: 31,387,834 E130G possibly damaging Het
Slc29a3 A G 10: 60,752,784 probably benign Het
Slco1a5 A G 6: 142,248,717 L400P probably damaging Het
Snd1 A G 6: 28,874,859 probably null Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tas2r110 A T 6: 132,868,053 I16L probably benign Het
Tmx3 T A 18: 90,527,934 V213D possibly damaging Het
Uba2 A T 7: 34,165,490 probably null Het
Wfikkn1 T A 17: 25,878,912 D112V probably damaging Het
Zfhx4 A G 3: 5,402,138 N2452S probably damaging Het
Other mutations in Rhd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01862:Rhd APN 4 134890339 missense possibly damaging 0.68
IGL02393:Rhd APN 4 134884095 missense probably benign 0.00
IGL02445:Rhd APN 4 134884170 missense possibly damaging 0.95
IGL02863:Rhd APN 4 134885310 missense probably damaging 0.99
R0762:Rhd UTSW 4 134876301 splice site probably benign
R5372:Rhd UTSW 4 134884632 missense possibly damaging 0.83
R5461:Rhd UTSW 4 134884617 missense probably damaging 1.00
R6378:Rhd UTSW 4 134894385 missense possibly damaging 0.95
R7564:Rhd UTSW 4 134876459 missense probably damaging 1.00
R7685:Rhd UTSW 4 134884509 splice site probably null
R8072:Rhd UTSW 4 134884149 missense possibly damaging 0.51
Z1176:Rhd UTSW 4 134879975 missense probably benign 0.12
Z1176:Rhd UTSW 4 134884524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCAATCTCTCCTAATTTAAGA -3'
(R):5'- TGGACCAGAACTTTAATGAGGTGTAT -3'

Sequencing Primer
(F):5'- TTTTGAAAGTGACAGCCAGGTG -3'
(R):5'- GAACTTTAATGAGGTGTATTCATCCC -3'
Posted On2017-02-28