Incidental Mutation 'R5938:Emc1'
ID 462364
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 044131-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R5938 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 139084931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 167 (H167Q)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: H167Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: H167Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: H167Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: H167Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144335
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: H167Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: H167Q

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,333,400 (GRCm39) D503E possibly damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Cacna1d C T 14: 29,825,692 (GRCm39) V1001I probably damaging Het
Calhm3 T C 19: 47,140,516 (GRCm39) I192M probably damaging Het
Cep44 A G 8: 57,000,457 (GRCm39) S19P possibly damaging Het
Cxcl15 T A 5: 90,949,225 (GRCm39) I130K unknown Het
Cxcl3 C T 5: 90,934,175 (GRCm39) probably benign Het
Epb41l3 T G 17: 69,566,066 (GRCm39) Y416D probably damaging Het
Erbb2 G A 11: 98,326,397 (GRCm39) R1007H probably damaging Het
Esr1 A G 10: 4,916,245 (GRCm39) probably benign Het
Fat4 G A 3: 39,005,388 (GRCm39) R1929Q probably damaging Het
Fsip2 T A 2: 82,807,835 (GRCm39) C1385S probably benign Het
Gbf1 T C 19: 46,256,891 (GRCm39) I777T probably damaging Het
Gm16092 T G 1: 85,440,689 (GRCm39) noncoding transcript Het
Greb1 T A 12: 16,767,259 (GRCm39) K314N probably damaging Het
Iigp1c C A 18: 60,378,724 (GRCm39) N86K probably damaging Het
Ipcef1 A G 10: 6,858,029 (GRCm39) probably benign Het
Iqank1 G A 15: 75,917,281 (GRCm39) E305K possibly damaging Het
Mgat4a C A 1: 37,491,344 (GRCm39) L292F probably damaging Het
Mill1 A G 7: 17,996,613 (GRCm39) N143S probably benign Het
Mindy1 A G 3: 95,201,067 (GRCm39) T324A probably benign Het
Mpdz T A 4: 81,202,851 (GRCm39) H1882L probably damaging Het
Ncapg2 T A 12: 116,393,277 (GRCm39) W494R probably damaging Het
Oas1c A T 5: 120,943,598 (GRCm39) H180Q probably benign Het
Or2q1 T A 6: 42,794,701 (GRCm39) C99S probably damaging Het
Or4c108 T C 2: 88,803,357 (GRCm39) M293V probably benign Het
Or4k49 A G 2: 111,494,708 (GRCm39) M46V probably benign Het
Or5ak20 A T 2: 85,183,620 (GRCm39) S217T probably damaging Het
Or6c88 A G 10: 129,407,396 (GRCm39) R291G probably damaging Het
Pelp1 A G 11: 70,285,693 (GRCm39) V725A probably damaging Het
Plxna4 T C 6: 32,211,541 (GRCm39) E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,059,755 (GRCm39) probably benign Het
Prdm16 T C 4: 154,432,411 (GRCm39) D285G probably damaging Het
Rasa2 A G 9: 96,493,442 (GRCm39) S81P possibly damaging Het
Rhd T A 4: 134,623,287 (GRCm39) F418Y probably benign Het
Rnf207 T C 4: 152,402,385 (GRCm39) probably benign Het
Rsf1 C T 7: 97,334,766 (GRCm39) R1300C probably damaging Het
Ryr1 A C 7: 28,746,290 (GRCm39) L3830R probably damaging Het
Sgsh A G 11: 119,237,625 (GRCm39) Y330H probably benign Het
Sh3bp5 T C 14: 31,109,791 (GRCm39) E130G possibly damaging Het
Slc29a3 A G 10: 60,588,563 (GRCm39) probably benign Het
Slco1a5 A G 6: 142,194,443 (GRCm39) L400P probably damaging Het
Snd1 A G 6: 28,874,858 (GRCm39) probably null Het
Sox15 C T 11: 69,546,556 (GRCm39) R120C probably damaging Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tas2r110 A T 6: 132,845,016 (GRCm39) I16L probably benign Het
Tmx3 T A 18: 90,546,058 (GRCm39) V213D possibly damaging Het
Uba2 A T 7: 33,864,915 (GRCm39) probably null Het
Wfikkn1 T A 17: 26,097,886 (GRCm39) D112V probably damaging Het
Zfhx4 A G 3: 5,467,198 (GRCm39) N2452S probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTCTGACTCAGCAAACTTCAGC -3'
(R):5'- TGGCAGCTCTCATGTCACAG -3'

Sequencing Primer
(F):5'- TGACTCAGCAAACTTCAGCAAACAG -3'
(R):5'- TTCCAAGTACACTCCAAGTATGTAGC -3'
Posted On 2017-02-28