Incidental Mutation 'R0567:Apcdd1'
ID46237
Institutional Source Beutler Lab
Gene Symbol Apcdd1
Ensembl Gene ENSMUSG00000071847
Gene Nameadenomatosis polyposis coli down-regulated 1
SynonymsDrapc1, EIG180
MMRRC Submission 038758-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R0567 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location62922327-62953195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62934036 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 74 (E74K)
Ref Sequence ENSEMBL: ENSMUSP00000125868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096554
AA Change: E74K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: E74K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163716
AA Change: E74K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: E74K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
APCDDC 51 283 3.3e-140 SMART
APCDDC 284 500 6.26e-91 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 A G 4: 86,228,016 E303G probably damaging Het
Akr1b3 A T 6: 34,304,345 probably null Het
Alox8 A T 11: 69,191,522 probably null Het
Atr T C 9: 95,865,829 V388A probably benign Het
AW554918 G A 18: 25,400,035 E452K possibly damaging Het
C1galt1 A G 6: 7,866,874 D240G probably damaging Het
Ccdc130 A G 8: 84,260,665 L93P probably damaging Het
Ceacam10 T A 7: 24,778,409 D116E probably damaging Het
Col15a1 G T 4: 47,293,231 V912L possibly damaging Het
Cyp3a11 G A 5: 145,869,149 T136I probably damaging Het
Denr C T 5: 123,908,158 T17M probably benign Het
Doc2b A G 11: 75,780,124 F227S probably damaging Het
Dsp A T 13: 38,192,438 T1400S probably benign Het
Egfr A T 11: 16,872,873 D412V probably benign Het
Fryl C T 5: 73,065,391 G1949D possibly damaging Het
Gstp3 A T 19: 4,057,636 L176Q possibly damaging Het
Heatr5a T A 12: 51,910,089 N1075I probably damaging Het
Hist1h2ah T C 13: 22,035,564 probably benign Het
Ighv1-69 C T 12: 115,623,549 probably benign Het
Lama3 A G 18: 12,549,252 I1092V probably benign Het
Lipg A T 18: 74,957,369 H36Q probably benign Het
Myh7b T C 2: 155,626,398 W836R probably damaging Het
Oit3 A T 10: 59,435,978 C186S probably damaging Het
Olfr734 A T 14: 50,320,658 M59K probably damaging Het
P2ry2 T C 7: 100,998,541 T186A probably damaging Het
Pyroxd2 T C 19: 42,735,925 T300A probably benign Het
Rab26 C A 17: 24,529,582 V283F probably damaging Het
Rad50 C T 11: 53,654,956 R1180Q probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Shroom3 A G 5: 92,964,453 D1891G possibly damaging Het
Syne2 G A 12: 75,890,230 E201K probably damaging Het
Taf6 A T 5: 138,183,726 probably null Het
Tbc1d32 A T 10: 56,173,963 M493K possibly damaging Het
Uaca A G 9: 60,871,381 T1017A probably benign Het
Usp17le C T 7: 104,768,898 V346I possibly damaging Het
Vmn1r71 T C 7: 10,748,629 D44G probably damaging Het
Vmn2r80 A G 10: 79,194,831 I830M possibly damaging Het
Zfp994 T C 17: 22,200,468 Y500C possibly damaging Het
Zscan20 A G 4: 128,589,450 probably null Het
Other mutations in Apcdd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Apcdd1 APN 18 62933865 splice site probably benign
IGL01522:Apcdd1 APN 18 62952115 missense possibly damaging 0.50
IGL01637:Apcdd1 APN 18 62937286 missense probably damaging 1.00
IGL02069:Apcdd1 APN 18 62949983 missense probably damaging 1.00
IGL02183:Apcdd1 APN 18 62951854 missense probably damaging 0.98
IGL02268:Apcdd1 APN 18 62950188 missense probably damaging 0.99
IGL02664:Apcdd1 APN 18 62951820 splice site probably benign
R0207:Apcdd1 UTSW 18 62950079 missense probably benign 0.04
R0363:Apcdd1 UTSW 18 62937097 missense possibly damaging 0.46
R0540:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0607:Apcdd1 UTSW 18 62951896 missense possibly damaging 0.82
R0629:Apcdd1 UTSW 18 62933970 missense probably damaging 1.00
R1118:Apcdd1 UTSW 18 62952024 missense probably benign
R1178:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1180:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R1181:Apcdd1 UTSW 18 62937097 missense probably damaging 1.00
R4363:Apcdd1 UTSW 18 62951932 missense possibly damaging 0.95
R5534:Apcdd1 UTSW 18 62937034 missense probably benign 0.01
R5622:Apcdd1 UTSW 18 62936902 splice site probably null
R5771:Apcdd1 UTSW 18 62936956 missense probably damaging 1.00
R5852:Apcdd1 UTSW 18 62937063 missense probably damaging 1.00
R5934:Apcdd1 UTSW 18 62951869 missense possibly damaging 0.72
R6109:Apcdd1 UTSW 18 62937366 missense probably damaging 1.00
R6515:Apcdd1 UTSW 18 62951839 missense probably damaging 1.00
R6625:Apcdd1 UTSW 18 62951858 missense probably damaging 1.00
R6831:Apcdd1 UTSW 18 62950126 nonsense probably null
R6931:Apcdd1 UTSW 18 62933908 missense probably damaging 1.00
R7018:Apcdd1 UTSW 18 62937049 missense probably damaging 0.98
R7115:Apcdd1 UTSW 18 62936953 missense probably damaging 1.00
R7148:Apcdd1 UTSW 18 62951845 missense probably damaging 1.00
R7326:Apcdd1 UTSW 18 62952188 nonsense probably null
R8025:Apcdd1 UTSW 18 62936908 missense probably damaging 1.00
X0028:Apcdd1 UTSW 18 62937130 missense possibly damaging 0.59
Z1088:Apcdd1 UTSW 18 62937183 missense probably benign 0.18
Z1177:Apcdd1 UTSW 18 62922691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGGGACTGCTGATTTGCTTAC -3'
(R):5'- TGGCAAAACGCAGACGCTTAATTTC -3'

Sequencing Primer
(F):5'- GACTGCTGATTTGCTTACTTTCTG -3'
(R):5'- CACTCACACCGTGTAGTGTAG -3'
Posted On2013-06-11