Mutagenetix > Incidental Mutations

Incidental Mutation 'R0567:Apcdd1'

46237

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

038758-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R0567 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62934036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 74 (E74K)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096554
AA Change: E74K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: E74K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163716
AA Change: E74K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: E74K

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	A	G	4: 86,228,016	E303G	probably damaging	Het
Akr1b3	A	T	6: 34,304,345		probably null	Het
Alox8	A	T	11: 69,191,522		probably null	Het
Atr	T	C	9: 95,865,829	V388A	probably benign	Het
AW554918	G	A	18: 25,400,035	E452K	possibly damaging	Het
C1galt1	A	G	6: 7,866,874	D240G	probably damaging	Het
Ccdc130	A	G	8: 84,260,665	L93P	probably damaging	Het
Ceacam10	T	A	7: 24,778,409	D116E	probably damaging	Het
Col15a1	G	T	4: 47,293,231	V912L	possibly damaging	Het
Cyp3a11	G	A	5: 145,869,149	T136I	probably damaging	Het
Denr	C	T	5: 123,908,158	T17M	probably benign	Het
Doc2b	A	G	11: 75,780,124	F227S	probably damaging	Het
Dsp	A	T	13: 38,192,438	T1400S	probably benign	Het
Egfr	A	T	11: 16,872,873	D412V	probably benign	Het
Fryl	C	T	5: 73,065,391	G1949D	possibly damaging	Het
Gstp3	A	T	19: 4,057,636	L176Q	possibly damaging	Het
Heatr5a	T	A	12: 51,910,089	N1075I	probably damaging	Het
Hist1h2ah	T	C	13: 22,035,564		probably benign	Het
Ighv1-69	C	T	12: 115,623,549		probably benign	Het
Lama3	A	G	18: 12,549,252	I1092V	probably benign	Het
Lipg	A	T	18: 74,957,369	H36Q	probably benign	Het
Myh7b	T	C	2: 155,626,398	W836R	probably damaging	Het
Oit3	A	T	10: 59,435,978	C186S	probably damaging	Het
Olfr734	A	T	14: 50,320,658	M59K	probably damaging	Het
P2ry2	T	C	7: 100,998,541	T186A	probably damaging	Het
Pyroxd2	T	C	19: 42,735,925	T300A	probably benign	Het
Rab26	C	A	17: 24,529,582	V283F	probably damaging	Het
Rad50	C	T	11: 53,654,956	R1180Q	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Shroom3	A	G	5: 92,964,453	D1891G	possibly damaging	Het
Syne2	G	A	12: 75,890,230	E201K	probably damaging	Het
Taf6	A	T	5: 138,183,726		probably null	Het
Tbc1d32	A	T	10: 56,173,963	M493K	possibly damaging	Het
Uaca	A	G	9: 60,871,381	T1017A	probably benign	Het
Usp17le	C	T	7: 104,768,898	V346I	possibly damaging	Het
Vmn1r71	T	C	7: 10,748,629	D44G	probably damaging	Het
Vmn2r80	A	G	10: 79,194,831	I830M	possibly damaging	Het
Zfp994	T	C	17: 22,200,468	Y500C	possibly damaging	Het
Zscan20	A	G	4: 128,589,450		probably null	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R6931:Apcdd1	UTSW	18	62933908	missense	probably damaging	1.00
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCAGGGACTGCTGATTTGCTTAC -3'
(R):5'- TGGCAAAACGCAGACGCTTAATTTC -3'

Sequencing Primer
(F):5'- GACTGCTGATTTGCTTACTTTCTG -3'
(R):5'- CACTCACACCGTGTAGTGTAG -3'

Posted On

2013-06-11