Incidental Mutation 'R5938:Olfr794'
ID462388
Institutional Source Beutler Lab
Gene Symbol Olfr794
Ensembl Gene ENSMUSG00000044293
Gene Nameolfactory receptor 794
SynonymsGA_x6K02T2PULF-11248702-11249664, MOR114-11
MMRRC Submission 044131-MU
Accession Numbers

Genbank: NM_146378

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5938 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129567655-129573110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129571527 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 291 (R291G)
Ref Sequence ENSEMBL: ENSMUSP00000145301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059957] [ENSMUST00000204820]
Predicted Effect probably damaging
Transcript: ENSMUST00000059957
AA Change: R291G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049790
Gene: ENSMUSG00000044293
AA Change: R291G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204820
AA Change: R291G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145301
Gene: ENSMUSG00000044293
AA Change: R291G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Meta Mutation Damage Score 0.5665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,442,574 D503E possibly damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Cacna1d C T 14: 30,103,735 V1001I probably damaging Het
Calhm3 T C 19: 47,152,077 I192M probably damaging Het
Cep44 A G 8: 56,547,422 S19P possibly damaging Het
Cxcl15 T A 5: 90,801,366 I130K unknown Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Emc1 T G 4: 139,357,620 H167Q probably benign Het
Epb41l3 T G 17: 69,259,071 Y416D probably damaging Het
Erbb2 G A 11: 98,435,571 R1007H probably damaging Het
Esr1 A G 10: 4,966,245 probably benign Het
Fat4 G A 3: 38,951,239 R1929Q probably damaging Het
Fsip2 T A 2: 82,977,491 C1385S probably benign Het
Gbf1 T C 19: 46,268,452 I777T probably damaging Het
Gm13762 T C 2: 88,973,013 M293V probably benign Het
Gm16092 T G 1: 85,512,968 noncoding transcript Het
Gm4951 C A 18: 60,245,652 N86K probably damaging Het
Greb1 T A 12: 16,717,258 K314N probably damaging Het
Ipcef1 A G 10: 6,908,029 probably benign Het
K230010J24Rik G A 15: 76,045,432 E305K possibly damaging Het
Mgat4a C A 1: 37,452,263 L292F probably damaging Het
Mill1 A G 7: 18,262,688 N143S probably benign Het
Mindy1 A G 3: 95,293,756 T324A probably benign Het
Mpdz T A 4: 81,284,614 H1882L probably damaging Het
Ncapg2 T A 12: 116,429,657 W494R probably damaging Het
Oas1c A T 5: 120,805,533 H180Q probably benign Het
Olfr1299 A G 2: 111,664,363 M46V probably benign Het
Olfr450 T A 6: 42,817,767 C99S probably damaging Het
Olfr988 A T 2: 85,353,276 S217T probably damaging Het
Pelp1 A G 11: 70,394,867 V725A probably damaging Het
Plxna4 T C 6: 32,234,606 E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prdm16 T C 4: 154,347,954 D285G probably damaging Het
Rasa2 A G 9: 96,611,389 S81P possibly damaging Het
Rhd T A 4: 134,895,976 F418Y probably benign Het
Rnf207 T C 4: 152,317,928 probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Ryr1 A C 7: 29,046,865 L3830R probably damaging Het
Sgsh A G 11: 119,346,799 Y330H probably benign Het
Sh3bp5 T C 14: 31,387,834 E130G possibly damaging Het
Slc29a3 A G 10: 60,752,784 probably benign Het
Slco1a5 A G 6: 142,248,717 L400P probably damaging Het
Snd1 A G 6: 28,874,859 probably null Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tas2r110 A T 6: 132,868,053 I16L probably benign Het
Tmx3 T A 18: 90,527,934 V213D possibly damaging Het
Uba2 A T 7: 34,165,490 probably null Het
Wfikkn1 T A 17: 25,878,912 D112V probably damaging Het
Zfhx4 A G 3: 5,402,138 N2452S probably damaging Het
Other mutations in Olfr794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Olfr794 APN 10 129570827 missense possibly damaging 0.95
IGL02157:Olfr794 APN 10 129571150 missense probably damaging 1.00
IGL02804:Olfr794 APN 10 129571437 missense possibly damaging 0.60
IGL02833:Olfr794 APN 10 129570750 missense probably benign 0.26
IGL02930:Olfr794 APN 10 129571315 missense probably damaging 1.00
IGL03038:Olfr794 APN 10 129570921 missense probably benign 0.07
G4846:Olfr794 UTSW 10 129571170 missense probably damaging 1.00
R1539:Olfr794 UTSW 10 129570771 missense probably damaging 0.99
R1737:Olfr794 UTSW 10 129570828 missense probably damaging 1.00
R1845:Olfr794 UTSW 10 129571348 missense probably damaging 1.00
R2198:Olfr794 UTSW 10 129571046 nonsense probably null
R3086:Olfr794 UTSW 10 129571407 missense probably damaging 1.00
R4960:Olfr794 UTSW 10 129571026 missense probably damaging 1.00
R6326:Olfr794 UTSW 10 129570702 missense possibly damaging 0.74
R6598:Olfr794 UTSW 10 129571369 missense probably damaging 1.00
R7034:Olfr794 UTSW 10 129571072 missense possibly damaging 0.91
R7066:Olfr794 UTSW 10 129571504 missense probably damaging 1.00
R7226:Olfr794 UTSW 10 129570715 missense probably benign 0.01
R7324:Olfr794 UTSW 10 129570849 missense probably damaging 1.00
R7408:Olfr794 UTSW 10 129570624 start gained probably benign
R7779:Olfr794 UTSW 10 129571311 missense probably damaging 1.00
Z1176:Olfr794 UTSW 10 129571236 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTGCAGTGCTGACTTTCATC -3'
(R):5'- CTGGGTTTCCAAATCAAGATGTAAAGG -3'

Sequencing Primer
(F):5'- CTCATCAGAGGAAGAAAGCATTTTCC -3'
(R):5'- GGATTATGAAAAAGTTAACCTGGCTG -3'
Posted On2017-02-28