Incidental Mutation 'R5938:Aatf'
ID462392
Institutional Source Beutler Lab
Gene Symbol Aatf
Ensembl Gene ENSMUSG00000018697
Gene Nameapoptosis antagonizing transcription factor
SynonymsTrb, 4933415H02Rik, 5830465M17Rik, Che-1
MMRRC Submission 044131-MU
Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5938 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84422855-84513522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84442574 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 503 (D503E)
Ref Sequence ENSEMBL: ENSMUSP00000018841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018841]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018841
AA Change: D503E

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: D503E

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 91 119 N/A INTRINSIC
low complexity region 130 173 N/A INTRINSIC
Pfam:AATF-Che1 187 339 4.6e-40 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:TRAUB 430 514 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141093
Meta Mutation Damage Score 0.2807 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
MGI Phenotype Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Cacna1d C T 14: 30,103,735 V1001I probably damaging Het
Calhm3 T C 19: 47,152,077 I192M probably damaging Het
Cep44 A G 8: 56,547,422 S19P possibly damaging Het
Cxcl15 T A 5: 90,801,366 I130K unknown Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Emc1 T G 4: 139,357,620 H167Q probably benign Het
Epb41l3 T G 17: 69,259,071 Y416D probably damaging Het
Erbb2 G A 11: 98,435,571 R1007H probably damaging Het
Esr1 A G 10: 4,966,245 probably benign Het
Fat4 G A 3: 38,951,239 R1929Q probably damaging Het
Fsip2 T A 2: 82,977,491 C1385S probably benign Het
Gbf1 T C 19: 46,268,452 I777T probably damaging Het
Gm13762 T C 2: 88,973,013 M293V probably benign Het
Gm16092 T G 1: 85,512,968 noncoding transcript Het
Gm4951 C A 18: 60,245,652 N86K probably damaging Het
Greb1 T A 12: 16,717,258 K314N probably damaging Het
Ipcef1 A G 10: 6,908,029 probably benign Het
K230010J24Rik G A 15: 76,045,432 E305K possibly damaging Het
Mgat4a C A 1: 37,452,263 L292F probably damaging Het
Mill1 A G 7: 18,262,688 N143S probably benign Het
Mindy1 A G 3: 95,293,756 T324A probably benign Het
Mpdz T A 4: 81,284,614 H1882L probably damaging Het
Ncapg2 T A 12: 116,429,657 W494R probably damaging Het
Oas1c A T 5: 120,805,533 H180Q probably benign Het
Olfr1299 A G 2: 111,664,363 M46V probably benign Het
Olfr450 T A 6: 42,817,767 C99S probably damaging Het
Olfr794 A G 10: 129,571,527 R291G probably damaging Het
Olfr988 A T 2: 85,353,276 S217T probably damaging Het
Pelp1 A G 11: 70,394,867 V725A probably damaging Het
Plxna4 T C 6: 32,234,606 E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prdm16 T C 4: 154,347,954 D285G probably damaging Het
Rasa2 A G 9: 96,611,389 S81P possibly damaging Het
Rhd T A 4: 134,895,976 F418Y probably benign Het
Rnf207 T C 4: 152,317,928 probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Ryr1 A C 7: 29,046,865 L3830R probably damaging Het
Sgsh A G 11: 119,346,799 Y330H probably benign Het
Sh3bp5 T C 14: 31,387,834 E130G possibly damaging Het
Slc29a3 A G 10: 60,752,784 probably benign Het
Slco1a5 A G 6: 142,248,717 L400P probably damaging Het
Snd1 A G 6: 28,874,859 probably null Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tas2r110 A T 6: 132,868,053 I16L probably benign Het
Tmx3 T A 18: 90,527,934 V213D possibly damaging Het
Uba2 A T 7: 34,165,490 probably null Het
Wfikkn1 T A 17: 25,878,912 D112V probably damaging Het
Zfhx4 A G 3: 5,402,138 N2452S probably damaging Het
Other mutations in Aatf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Aatf APN 11 84470557 splice site probably benign
IGL01482:Aatf APN 11 84470710 missense possibly damaging 0.51
IGL01775:Aatf APN 11 84471137 missense probably damaging 1.00
IGL02881:Aatf APN 11 84471289 splice site probably benign
R0183:Aatf UTSW 11 84510425 splice site probably null
R0200:Aatf UTSW 11 84445676 missense probably damaging 1.00
R0257:Aatf UTSW 11 84510281 missense probably benign 0.33
R0324:Aatf UTSW 11 84512139 critical splice donor site probably null
R0494:Aatf UTSW 11 84511513 missense probably benign
R0544:Aatf UTSW 11 84423005 missense probably benign 0.09
R1186:Aatf UTSW 11 84470549 splice site probably benign
R2339:Aatf UTSW 11 84511497 missense probably benign 0.00
R4626:Aatf UTSW 11 84422958 makesense probably null
R4647:Aatf UTSW 11 84471197 missense possibly damaging 0.69
R4697:Aatf UTSW 11 84449138 missense probably damaging 1.00
R4981:Aatf UTSW 11 84511497 missense probably benign 0.00
R5490:Aatf UTSW 11 84510273 missense probably damaging 1.00
R6267:Aatf UTSW 11 84473100 missense probably benign 0.09
R6296:Aatf UTSW 11 84473100 missense probably benign 0.09
R6633:Aatf UTSW 11 84511482 critical splice donor site probably null
R7081:Aatf UTSW 11 84471125 missense possibly damaging 0.84
R7212:Aatf UTSW 11 84449180 missense probably damaging 0.98
R7545:Aatf UTSW 11 84470676 missense probably benign 0.04
R7754:Aatf UTSW 11 84511509 missense possibly damaging 0.53
R7871:Aatf UTSW 11 84471038 frame shift probably null
R8411:Aatf UTSW 11 84470676 missense probably benign 0.04
X0018:Aatf UTSW 11 84510385 missense possibly damaging 0.85
Z1176:Aatf UTSW 11 84442585 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCCATGAGAGGAGCAGATG -3'
(R):5'- AGTGCCTGTGAACTTTCCC -3'

Sequencing Primer
(F):5'- CAGGGGGACTAATGCTGAC -3'
(R):5'- GTGAACTTTCCCACACTCCACTG -3'
Posted On2017-02-28