Incidental Mutation 'R5938:Erbb2'
ID462393
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission 044131-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5938 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98435571 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1007 (R1007H)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002655] [ENSMUST00000058295]
Predicted Effect probably benign
Transcript: ENSMUST00000002655
SMART Domains Protein: ENSMUSP00000002655
Gene: ENSMUSG00000002580

DomainStartEndE-ValueType
Pfam:Rdx 23 96 1.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058295
AA Change: R1007H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: R1007H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154452
Meta Mutation Damage Score 0.2020 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,442,574 D503E possibly damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Cacna1d C T 14: 30,103,735 V1001I probably damaging Het
Calhm3 T C 19: 47,152,077 I192M probably damaging Het
Cep44 A G 8: 56,547,422 S19P possibly damaging Het
Cxcl15 T A 5: 90,801,366 I130K unknown Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Emc1 T G 4: 139,357,620 H167Q probably benign Het
Epb41l3 T G 17: 69,259,071 Y416D probably damaging Het
Esr1 A G 10: 4,966,245 probably benign Het
Fat4 G A 3: 38,951,239 R1929Q probably damaging Het
Fsip2 T A 2: 82,977,491 C1385S probably benign Het
Gbf1 T C 19: 46,268,452 I777T probably damaging Het
Gm13762 T C 2: 88,973,013 M293V probably benign Het
Gm16092 T G 1: 85,512,968 noncoding transcript Het
Gm4951 C A 18: 60,245,652 N86K probably damaging Het
Greb1 T A 12: 16,717,258 K314N probably damaging Het
Ipcef1 A G 10: 6,908,029 probably benign Het
K230010J24Rik G A 15: 76,045,432 E305K possibly damaging Het
Mgat4a C A 1: 37,452,263 L292F probably damaging Het
Mill1 A G 7: 18,262,688 N143S probably benign Het
Mindy1 A G 3: 95,293,756 T324A probably benign Het
Mpdz T A 4: 81,284,614 H1882L probably damaging Het
Ncapg2 T A 12: 116,429,657 W494R probably damaging Het
Oas1c A T 5: 120,805,533 H180Q probably benign Het
Olfr1299 A G 2: 111,664,363 M46V probably benign Het
Olfr450 T A 6: 42,817,767 C99S probably damaging Het
Olfr794 A G 10: 129,571,527 R291G probably damaging Het
Olfr988 A T 2: 85,353,276 S217T probably damaging Het
Pelp1 A G 11: 70,394,867 V725A probably damaging Het
Plxna4 T C 6: 32,234,606 E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prdm16 T C 4: 154,347,954 D285G probably damaging Het
Rasa2 A G 9: 96,611,389 S81P possibly damaging Het
Rhd T A 4: 134,895,976 F418Y probably benign Het
Rnf207 T C 4: 152,317,928 probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Ryr1 A C 7: 29,046,865 L3830R probably damaging Het
Sgsh A G 11: 119,346,799 Y330H probably benign Het
Sh3bp5 T C 14: 31,387,834 E130G possibly damaging Het
Slc29a3 A G 10: 60,752,784 probably benign Het
Slco1a5 A G 6: 142,248,717 L400P probably damaging Het
Snd1 A G 6: 28,874,859 probably null Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tas2r110 A T 6: 132,868,053 I16L probably benign Het
Tmx3 T A 18: 90,527,934 V213D possibly damaging Het
Uba2 A T 7: 34,165,490 probably null Het
Wfikkn1 T A 17: 25,878,912 D112V probably damaging Het
Zfhx4 A G 3: 5,402,138 N2452S probably damaging Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1807:Erbb2 UTSW 11 98428854 missense probably damaging 1.00
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R2051:Erbb2 UTSW 11 98420172 missense probably damaging 1.00
R3147:Erbb2 UTSW 11 98434039 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4240:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R6062:Erbb2 UTSW 11 98433249 missense probably damaging 1.00
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6514:Erbb2 UTSW 11 98420146 missense probably benign 0.03
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
R7686:Erbb2 UTSW 11 98435573 missense probably benign
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATTCTCCCGTATGGCAAG -3'
(R):5'- ACCATCCCTATTCCGAGGTG -3'

Sequencing Primer
(F):5'- CAGCGCTTTGTGGTCATCCAG -3'
(R):5'- TATTCCGAGGTGGGCACTGAC -3'
Posted On2017-02-28