Incidental Mutation 'R5938:Calhm3'
ID462407
Institutional Source Beutler Lab
Gene Symbol Calhm3
Ensembl Gene ENSMUSG00000094219
Gene Namecalcium homeostasis modulator 3
Synonyms
MMRRC Submission 044131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5938 (G1)
Quality Score218
Status Validated
Chromosome19
Chromosomal Location47151609-47157764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47152077 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 192 (I192M)
Ref Sequence ENSEMBL: ENSMUSP00000136302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178630]
Predicted Effect probably damaging
Transcript: ENSMUST00000178630
AA Change: I192M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136302
Gene: ENSMUSG00000094219
AA Change: I192M

DomainStartEndE-ValueType
Pfam:Ca_hom_mod 1 252 1.9e-103 PFAM
low complexity region 268 278 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 94% (63/67)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf A C 11: 84,442,574 D503E possibly damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Cacna1d C T 14: 30,103,735 V1001I probably damaging Het
Cep44 A G 8: 56,547,422 S19P possibly damaging Het
Cxcl15 T A 5: 90,801,366 I130K unknown Het
Cxcl3 C T 5: 90,786,316 probably benign Het
Emc1 T G 4: 139,357,620 H167Q probably benign Het
Epb41l3 T G 17: 69,259,071 Y416D probably damaging Het
Erbb2 G A 11: 98,435,571 R1007H probably damaging Het
Esr1 A G 10: 4,966,245 probably benign Het
Fat4 G A 3: 38,951,239 R1929Q probably damaging Het
Fsip2 T A 2: 82,977,491 C1385S probably benign Het
Gbf1 T C 19: 46,268,452 I777T probably damaging Het
Gm13762 T C 2: 88,973,013 M293V probably benign Het
Gm16092 T G 1: 85,512,968 noncoding transcript Het
Gm4951 C A 18: 60,245,652 N86K probably damaging Het
Greb1 T A 12: 16,717,258 K314N probably damaging Het
Ipcef1 A G 10: 6,908,029 probably benign Het
K230010J24Rik G A 15: 76,045,432 E305K possibly damaging Het
Mgat4a C A 1: 37,452,263 L292F probably damaging Het
Mill1 A G 7: 18,262,688 N143S probably benign Het
Mindy1 A G 3: 95,293,756 T324A probably benign Het
Mpdz T A 4: 81,284,614 H1882L probably damaging Het
Ncapg2 T A 12: 116,429,657 W494R probably damaging Het
Oas1c A T 5: 120,805,533 H180Q probably benign Het
Olfr1299 A G 2: 111,664,363 M46V probably benign Het
Olfr450 T A 6: 42,817,767 C99S probably damaging Het
Olfr794 A G 10: 129,571,527 R291G probably damaging Het
Olfr988 A T 2: 85,353,276 S217T probably damaging Het
Pelp1 A G 11: 70,394,867 V725A probably damaging Het
Plxna4 T C 6: 32,234,606 E666G probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prdm16 T C 4: 154,347,954 D285G probably damaging Het
Rasa2 A G 9: 96,611,389 S81P possibly damaging Het
Rhd T A 4: 134,895,976 F418Y probably benign Het
Rnf207 T C 4: 152,317,928 probably benign Het
Rsf1 C T 7: 97,685,559 R1300C probably damaging Het
Ryr1 A C 7: 29,046,865 L3830R probably damaging Het
Sgsh A G 11: 119,346,799 Y330H probably benign Het
Sh3bp5 T C 14: 31,387,834 E130G possibly damaging Het
Slc29a3 A G 10: 60,752,784 probably benign Het
Slco1a5 A G 6: 142,248,717 L400P probably damaging Het
Snd1 A G 6: 28,874,859 probably null Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tas2r110 A T 6: 132,868,053 I16L probably benign Het
Tmx3 T A 18: 90,527,934 V213D possibly damaging Het
Uba2 A T 7: 34,165,490 probably null Het
Wfikkn1 T A 17: 25,878,912 D112V probably damaging Het
Zfhx4 A G 3: 5,402,138 N2452S probably damaging Het
Other mutations in Calhm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Calhm3 UTSW 19 47151896 frame shift probably null
R1203:Calhm3 UTSW 19 47155400 missense probably damaging 1.00
R1863:Calhm3 UTSW 19 47152100 missense probably damaging 1.00
R1911:Calhm3 UTSW 19 47155469 missense possibly damaging 0.74
R1951:Calhm3 UTSW 19 47151817 missense probably benign 0.00
R2089:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2091:Calhm3 UTSW 19 47151991 missense probably damaging 1.00
R2273:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2274:Calhm3 UTSW 19 47157547 missense probably damaging 0.96
R2436:Calhm3 UTSW 19 47151965 missense probably damaging 1.00
R3702:Calhm3 UTSW 19 47151748 missense possibly damaging 0.88
R5758:Calhm3 UTSW 19 47151751 missense probably damaging 0.99
R5901:Calhm3 UTSW 19 47157613 missense probably damaging 1.00
R6948:Calhm3 UTSW 19 47151905 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATTCTGGGATGCCACCAG -3'
(R):5'- ATGAATCTGGAGGACGCGTG -3'

Sequencing Primer
(F):5'- ACGTAGCTCGCTCTGCATG -3'
(R):5'- TGGCAGGATGGTGACCG -3'
Posted On2017-02-28