Incidental Mutation 'R5939:Tmem70'
ID462408
Institutional Source Beutler Lab
Gene Symbol Tmem70
Ensembl Gene ENSMUSG00000025940
Gene Nametransmembrane protein 70
Synonyms
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location16665207-16678275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16677391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 243 (V243A)
Ref Sequence ENSEMBL: ENSMUSP00000070497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065373] [ENSMUST00000177501]
Predicted Effect probably benign
Transcript: ENSMUST00000065373
AA Change: V243A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000070497
Gene: ENSMUSG00000025940
AA Change: V243A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:DUF1301 102 234 1.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177501
AA Change: V244A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135483
Gene: ENSMUSG00000025940
AA Change: V244A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:TMEM70 104 235 2.4e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177532
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a mitochondrial membrane protein. The encoded protein may play a role in biogenesis of mitochondrial ATP synthase. Mutations in this gene have been associated with neonatal mitochondrial encephalocardiomyopathy due to ATP synthase deficiency. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality during organogenesis associated with severe growth delay, impaired biosynthesis and assembly of ATP synthase, decreased ATP production, oxidative stress, delayed heart development, and altered mitochondrial ultrastructure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Tmem70
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1856:Tmem70 UTSW 1 16677273 missense probably damaging 1.00
R2496:Tmem70 UTSW 1 16665351 missense probably benign 0.02
R3040:Tmem70 UTSW 1 16667765 missense possibly damaging 0.47
R5853:Tmem70 UTSW 1 16665332 missense possibly damaging 0.96
R6707:Tmem70 UTSW 1 16677307 missense probably damaging 1.00
R6942:Tmem70 UTSW 1 16677156 missense probably damaging 1.00
R7260:Tmem70 UTSW 1 16665366 missense possibly damaging 0.58
R7899:Tmem70 UTSW 1 16677044 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACAGTGTTTCACCAAGAC -3'
(R):5'- ACATGGCTCAGATGTGGTGG -3'

Sequencing Primer
(F):5'- TGTTTCACCAAGACGACGTG -3'
(R):5'- CTGCTTCTATGAAGGCCAATTCTAGG -3'
Posted On2017-02-28