Incidental Mutation 'R5939:Rab23'
ID462409
Institutional Source Beutler Lab
Gene Symbol Rab23
Ensembl Gene ENSMUSG00000004768
Gene NameRAB23, member RAS oncogene family
Synonyms
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location33719887-33742564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33723909 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 20 (V20A)
Ref Sequence ENSEMBL: ENSMUSP00000137896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088287] [ENSMUST00000115174] [ENSMUST00000138024]
Predicted Effect probably damaging
Transcript: ENSMUST00000088287
AA Change: V20A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085625
Gene: ENSMUSG00000004768
AA Change: V20A

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115174
AA Change: V20A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110828
Gene: ENSMUSG00000004768
AA Change: V20A

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135330
Predicted Effect probably damaging
Transcript: ENSMUST00000138024
AA Change: V20A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137896
Gene: ENSMUSG00000004768
AA Change: V20A

DomainStartEndE-ValueType
Pfam:Miro 11 59 1.9e-6 PFAM
Pfam:Ras 11 61 6.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195006
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small GTPase of the Ras superfamily. Rab proteins are involved in the regulation of diverse cellular functions associated with intracellular membrane trafficking, including autophagy and immune response to bacterial infection. The encoded protein may play a role in central nervous system development by antagonizing sonic hedgehog signaling. Disruption of this gene has been implicated in Carpenter syndrome as well as cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a spontaneous allele show neural tube defects, exencephaly, spinal cord and dorsal root ganglia anomalies, malformed eyes and defects in the axial skeleton and developing limbs. Mice homozygous for an ENU-induced allele die in utero with exencephaly, polydactyly and eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Rab23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02531:Rab23 APN 1 33738280 splice site probably benign
R0309:Rab23 UTSW 1 33734861 splice site probably null
R0798:Rab23 UTSW 1 33734827 missense probably damaging 0.99
R1549:Rab23 UTSW 1 33738297 missense possibly damaging 0.91
R1668:Rab23 UTSW 1 33734854 nonsense probably null
R1976:Rab23 UTSW 1 33723938 missense probably damaging 0.99
R2240:Rab23 UTSW 1 33739325 missense probably benign
R2866:Rab23 UTSW 1 33738295 missense possibly damaging 0.75
R4476:Rab23 UTSW 1 33724892 intron probably benign
R4614:Rab23 UTSW 1 33739385 missense probably benign 0.01
R5884:Rab23 UTSW 1 33724886 intron probably benign
R7567:Rab23 UTSW 1 33734731 missense possibly damaging 0.91
X0018:Rab23 UTSW 1 33738336 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCGATTACTGCAGTGCTG -3'
(R):5'- AGCTGTACATGAGCGTCTGC -3'

Sequencing Primer
(F):5'- CTGTGTGATTGTCTCTTGATAGAAAC -3'
(R):5'- CACTGGCTGGCATGGTTAGAC -3'
Posted On2017-02-28