Incidental Mutation 'R5939:Olfr1120'
ID462412
Institutional Source Beutler Lab
Gene Symbol Olfr1120
Ensembl Gene ENSMUSG00000081234
Gene Nameolfactory receptor 1120
SynonymsMOR264-2, GA_x6K02T2Q125-48849180-48850100
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87354815-87361786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87357704 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 87 (I87L)
Ref Sequence ENSEMBL: ENSMUSP00000149911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058737] [ENSMUST00000215163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058737
AA Change: I87L

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051931
Gene: ENSMUSG00000081234
AA Change: I87L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 1.1e-54 PFAM
Pfam:7tm_1 47 296 7.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215163
AA Change: I87L

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215282
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Olfr1120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Olfr1120 APN 2 87357545 missense possibly damaging 0.82
IGL01680:Olfr1120 APN 2 87357905 missense probably damaging 1.00
IGL02210:Olfr1120 APN 2 87358003 missense probably damaging 1.00
R0624:Olfr1120 UTSW 2 87357682 nonsense probably null
R0849:Olfr1120 UTSW 2 87358265 missense probably benign 0.00
R1298:Olfr1120 UTSW 2 87358070 missense probably benign 0.20
R2309:Olfr1120 UTSW 2 87357954 missense probably damaging 1.00
R4237:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R4291:Olfr1120 UTSW 2 87358075 missense probably benign 0.00
R5679:Olfr1120 UTSW 2 87357545 missense possibly damaging 0.82
R6269:Olfr1120 UTSW 2 87846874 missense possibly damaging 0.65
R6551:Olfr1120 UTSW 2 87846661 missense possibly damaging 0.89
R7024:Olfr1120 UTSW 2 87357722 missense probably benign 0.06
R7242:Olfr1120 UTSW 2 87358082 missense probably benign 0.13
R7359:Olfr1120 UTSW 2 87358211 missense possibly damaging 0.77
R7444:Olfr1120 UTSW 2 87358100 missense possibly damaging 0.94
R7488:Olfr1120 UTSW 2 87358253 missense probably damaging 1.00
R7646:Olfr1120 UTSW 2 87357758 missense probably benign 0.00
R7711:Olfr1120 UTSW 2 87357527 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGTTTCTCTTACTGGGGTTC -3'
(R):5'- CAGCTGAGTGCACTTTGTTG -3'

Sequencing Primer
(F):5'- GGGTTCTCTGGCGTACCTAAC -3'
(R):5'- CACTTTGTTGGATTCATGACCAGAG -3'
Posted On2017-02-28