Incidental Mutation 'R5939:Olfr1167'
ID462413
Institutional Source Beutler Lab
Gene Symbol Olfr1167
Ensembl Gene ENSMUSG00000100899
Gene Nameolfactory receptor 1167
SynonymsMOR174-16, GA_x6K02T2Q125-49641892-49640942
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88146150-88155193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88149509 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 170 (Y170C)
Ref Sequence ENSEMBL: ENSMUSP00000149599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099832] [ENSMUST00000216951]
Predicted Effect probably damaging
Transcript: ENSMUST00000099832
AA Change: Y170C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097420
Gene: ENSMUSG00000100899
AA Change: Y170C

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.3e-47 PFAM
Pfam:7tm_1 43 292 3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216951
AA Change: Y170C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Olfr1167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Olfr1167 APN 2 88149260 missense possibly damaging 0.55
IGL01525:Olfr1167 APN 2 88149877 missense probably benign 0.15
IGL02008:Olfr1167 APN 2 88149578 missense probably damaging 1.00
IGL02116:Olfr1167 APN 2 88149288 missense probably benign 0.03
IGL02740:Olfr1167 APN 2 88149257 missense probably damaging 1.00
IGL03493:Olfr1167 APN 2 88149936 missense probably benign 0.02
PIT4498001:Olfr1167 UTSW 2 88149915 missense probably benign 0.00
R1951:Olfr1167 UTSW 2 88149297 missense possibly damaging 0.50
R2060:Olfr1167 UTSW 2 88149143 missense probably damaging 1.00
R4167:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4168:Olfr1167 UTSW 2 88149845 missense probably damaging 0.97
R4244:Olfr1167 UTSW 2 88149288 missense probably benign 0.00
R5363:Olfr1167 UTSW 2 88149802 missense probably damaging 1.00
R5778:Olfr1167 UTSW 2 88149617 missense probably damaging 1.00
R6502:Olfr1167 UTSW 2 88150016 start codon destroyed probably null 0.37
R7036:Olfr1167 UTSW 2 88149125 missense probably damaging 0.99
R7104:Olfr1167 UTSW 2 88149372 missense possibly damaging 0.65
R7340:Olfr1167 UTSW 2 88149276 missense possibly damaging 0.95
R7481:Olfr1167 UTSW 2 88149761 missense probably benign 0.12
R7615:Olfr1167 UTSW 2 88149518 missense probably benign 0.01
X0050:Olfr1167 UTSW 2 88149696 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAAATTGTTATGGCAGTCAAGTG -3'
(R):5'- AATGTTCATGTTAGCAGTGATGGC -3'

Sequencing Primer
(F):5'- ACAGGTGGAGAAGGCTTTTC -3'
(R):5'- CATGTTAGCAGTGATGGCCTATGAC -3'
Posted On2017-02-28