Incidental Mutation 'R5939:Duox1'
ID462414
Institutional Source Beutler Lab
Gene Symbol Duox1
Ensembl Gene ENSMUSG00000033268
Gene Namedual oxidase 1
SynonymsTHOX1, LNOX1, 9930101G15Rik, NOXEF1
MMRRC Submission 043243-MU
Accession Numbers

Genbank: NM_001099297; MGI: 2139422

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122315672-122347972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122346351 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1451 (H1451L)
Ref Sequence ENSEMBL: ENSMUSP00000097060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048635] [ENSMUST00000099461] [ENSMUST00000110530] [ENSMUST00000110531] [ENSMUST00000110532] [ENSMUST00000121237] [ENSMUST00000125826] [ENSMUST00000139819]
Predicted Effect probably benign
Transcript: ENSMUST00000048635
SMART Domains Protein: ENSMUSP00000045135
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099461
AA Change: H1451L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097060
Gene: ENSMUSG00000033268
AA Change: H1451L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:An_peroxidase 29 557 2.1e-134 PFAM
transmembrane domain 594 616 N/A INTRINSIC
EFh 819 847 1.82e-4 SMART
EFh 855 883 3.45e-5 SMART
transmembrane domain 1044 1066 N/A INTRINSIC
Pfam:Ferric_reduct 1087 1236 5.3e-21 PFAM
Pfam:FAD_binding_8 1272 1374 8.5e-21 PFAM
Pfam:NAD_binding_6 1380 1534 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110530
SMART Domains Protein: ENSMUSP00000106159
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
SH2 130 214 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110531
SMART Domains Protein: ENSMUSP00000106160
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 48 67 N/A INTRINSIC
SH2 136 220 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110532
SMART Domains Protein: ENSMUSP00000106161
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 19 38 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 77 87 N/A INTRINSIC
low complexity region 146 165 N/A INTRINSIC
Blast:SH2 225 278 2e-22 BLAST
SCOP:d1ayaa_ 237 291 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121237
SMART Domains Protein: ENSMUSP00000113923
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 42 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125826
SMART Domains Protein: ENSMUSP00000117099
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 56 N/A INTRINSIC
low complexity region 76 105 N/A INTRINSIC
low complexity region 129 148 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 187 197 N/A INTRINSIC
low complexity region 256 275 N/A INTRINSIC
SH2 344 428 9.16e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135848
Predicted Effect probably benign
Transcript: ENSMUST00000139819
SMART Domains Protein: ENSMUSP00000119980
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 83 102 N/A INTRINSIC
low complexity region 149 163 N/A INTRINSIC
SH2 218 302 9.16e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143484
SMART Domains Protein: ENSMUSP00000120732
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
SH2 71 155 3.19e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151130
SMART Domains Protein: ENSMUSP00000114524
Gene: ENSMUSG00000033256

DomainStartEndE-ValueType
low complexity region 6 48 N/A INTRINSIC
low complexity region 68 97 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes proteins encoded by this gene and the similar DUOX2 gene. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. This protein generates hydrogen peroxide and thereby plays a role in the activity of thyroid peroxidase, lactoperoxidase, and in lactoperoxidase-mediated antimicrobial defense at mucosal surfaces. Two alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI

All alleles(6) : Targeted, other(3) Gene trapped(3)

 

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Duox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Duox1 APN 2 122333141 missense possibly damaging 0.55
IGL00956:Duox1 APN 2 122323306 missense probably benign 0.42
IGL01413:Duox1 APN 2 122320710 missense probably benign 0.03
IGL01444:Duox1 APN 2 122340090 missense probably damaging 0.98
IGL01633:Duox1 APN 2 122333798 missense probably benign 0.00
IGL01814:Duox1 APN 2 122346272 missense probably damaging 0.99
IGL01868:Duox1 APN 2 122338407 missense probably benign
IGL02096:Duox1 APN 2 122344174 missense probably damaging 0.99
IGL02126:Duox1 APN 2 122346336 missense probably benign 0.21
IGL02342:Duox1 APN 2 122347312 missense probably damaging 1.00
IGL02687:Duox1 APN 2 122336415 missense probably damaging 1.00
IGL02708:Duox1 APN 2 122326017 missense possibly damaging 0.81
IGL02935:Duox1 APN 2 122324519 missense possibly damaging 0.56
Vaguely UTSW 2 122326135 nonsense probably null
D4043:Duox1 UTSW 2 122344795 missense probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0047:Duox1 UTSW 2 122346641 unclassified probably benign
R0241:Duox1 UTSW 2 122333397 splice site probably benign
R0479:Duox1 UTSW 2 122346380 missense probably damaging 1.00
R0834:Duox1 UTSW 2 122346501 missense probably damaging 1.00
R1105:Duox1 UTSW 2 122337702 missense probably damaging 0.97
R1205:Duox1 UTSW 2 122327925 nonsense probably null
R1281:Duox1 UTSW 2 122327088 missense probably damaging 1.00
R1302:Duox1 UTSW 2 122347279 missense probably benign 0.24
R1532:Duox1 UTSW 2 122344723 missense probably damaging 1.00
R1706:Duox1 UTSW 2 122319472 missense probably benign 0.01
R1719:Duox1 UTSW 2 122338644 missense possibly damaging 0.93
R1753:Duox1 UTSW 2 122333429 missense probably damaging 1.00
R1827:Duox1 UTSW 2 122347380 nonsense probably null
R1828:Duox1 UTSW 2 122347380 nonsense probably null
R1940:Duox1 UTSW 2 122325984 missense probably benign 0.06
R1944:Duox1 UTSW 2 122346520 missense probably damaging 0.99
R2069:Duox1 UTSW 2 122333062 missense probably benign
R2113:Duox1 UTSW 2 122337254 missense probably benign
R2202:Duox1 UTSW 2 122344713 missense probably benign 0.19
R2314:Duox1 UTSW 2 122333730 nonsense probably null
R2507:Duox1 UTSW 2 122333138 missense probably benign 0.34
R2508:Duox1 UTSW 2 122333138 missense probably benign 0.34
R3177:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R3277:Duox1 UTSW 2 122340116 missense probably damaging 1.00
R4124:Duox1 UTSW 2 122337421 missense probably damaging 1.00
R4271:Duox1 UTSW 2 122324375 missense probably damaging 0.96
R4411:Duox1 UTSW 2 122337634 missense probably benign 0.30
R4419:Duox1 UTSW 2 122327126 missense probably benign
R4420:Duox1 UTSW 2 122327126 missense probably benign
R4578:Duox1 UTSW 2 122333777 missense probably benign 0.15
R4628:Duox1 UTSW 2 122346252 missense probably damaging 1.00
R4665:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4666:Duox1 UTSW 2 122319475 missense probably benign 0.00
R4730:Duox1 UTSW 2 122333831 missense probably damaging 1.00
R4767:Duox1 UTSW 2 122333441 missense possibly damaging 0.79
R4857:Duox1 UTSW 2 122315731 missense probably benign 0.05
R4904:Duox1 UTSW 2 122320864 missense probably damaging 1.00
R5032:Duox1 UTSW 2 122337317 missense probably benign
R5201:Duox1 UTSW 2 122327922 missense probably benign
R5474:Duox1 UTSW 2 122346625 missense probably benign 0.02
R5835:Duox1 UTSW 2 122327860 missense probably benign 0.00
R5941:Duox1 UTSW 2 122344156 missense probably damaging 0.97
R5943:Duox1 UTSW 2 122333435 missense probably benign 0.00
R5970:Duox1 UTSW 2 122340201 missense probably damaging 1.00
R6023:Duox1 UTSW 2 122337684 missense probably benign 0.19
R6050:Duox1 UTSW 2 122319475 missense probably benign 0.00
R6064:Duox1 UTSW 2 122320762 missense probably benign 0.00
R6093:Duox1 UTSW 2 122347274 missense probably benign 0.01
R6188:Duox1 UTSW 2 122319794 missense probably benign 0.00
R6246:Duox1 UTSW 2 122327174 missense probably damaging 1.00
R6259:Duox1 UTSW 2 122344783 missense probably benign 0.00
R6290:Duox1 UTSW 2 122333807 missense possibly damaging 0.92
R6300:Duox1 UTSW 2 122337700 missense probably damaging 0.99
R6341:Duox1 UTSW 2 122337721 missense probably damaging 0.98
R6498:Duox1 UTSW 2 122319607 missense probably damaging 1.00
R6883:Duox1 UTSW 2 122324584 intron probably null
R7002:Duox1 UTSW 2 122319877 nonsense probably null
R7410:Duox1 UTSW 2 122346393 missense probably damaging 1.00
R7421:Duox1 UTSW 2 122323230 missense probably damaging 1.00
R7608:Duox1 UTSW 2 122326135 nonsense probably null
R7702:Duox1 UTSW 2 122329639 missense possibly damaging 0.86
R7766:Duox1 UTSW 2 122337301 missense probably benign
R7833:Duox1 UTSW 2 122324388 missense probably damaging 1.00
R7980:Duox1 UTSW 2 122347320 missense possibly damaging 0.71
R8275:Duox1 UTSW 2 122344768 missense probably benign 0.02
Z1176:Duox1 UTSW 2 122333038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGAGGCTGGCCCTACTTC -3'
(R):5'- GTTCAGCACCTTCTGGAAGTG -3'

Sequencing Primer
(F):5'- CTAGCTGAGGTCAGAATTCCATG -3'
(R):5'- TGCCGCTCACAGATGTAC -3'
Posted On2017-02-28