Mutagenetix > Incidental Mutations

Incidental Mutation 'R5939:Intu'

462415

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

043243-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5939 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40692584 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 629 (V629A)

Ref Sequence

ENSEMBL: ENSMUSP00000088725 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091186
AA Change: V629A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: V629A

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000204176

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	T	8: 24,914,122	F225I	probably damaging	Het
Ager	G	T	17: 34,598,201	C38F	probably damaging	Het
Arel1	C	A	12: 84,926,292	R577L	probably damaging	Het
Armh1	T	C	4: 117,229,922	Y182C	probably damaging	Het
BC005561	T	C	5: 104,519,207	Y532H	possibly damaging	Het
Cabp2	G	T	19: 4,086,470	C172F	possibly damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
D630045J12Rik	A	C	6: 38,194,969	S755A	possibly damaging	Het
Duox1	A	T	2: 122,346,351	H1451L	probably damaging	Het
Dync2h1	A	G	9: 7,037,801	V3359A	probably damaging	Het
Erlin2	T	C	8: 27,036,526	F305L	probably benign	Het
Gm10428	A	C	11: 62,753,462		probably benign	Het
Gnal	G	A	18: 67,191,385	V204M	probably damaging	Het
Lrguk	G	T	6: 34,078,753	C435F	probably damaging	Het
Man1c1	C	T	4: 134,565,836	V543M	probably damaging	Het
Mcm3ap	A	G	10: 76,508,361	H1779R	probably benign	Het
Neb	T	C	2: 52,257,594	T2776A	probably benign	Het
Nek10	A	T	14: 14,931,290	Y754F	possibly damaging	Het
Nr3c1	A	G	18: 39,420,653	I664T	probably benign	Het
Nrip1	T	C	16: 76,292,122	E849G	probably damaging	Het
Nrros	A	G	16: 32,143,454	F546L	probably benign	Het
Olfr1120	A	C	2: 87,357,704	I87L	possibly damaging	Het
Olfr1167	T	C	2: 88,149,509	Y170C	probably damaging	Het
Pcdhb16	A	G	18: 37,478,064	T26A	probably benign	Het
Penk	A	G	4: 4,138,010	F45S	probably benign	Het
Ppp2r3a	A	T	9: 101,212,625	N166K	probably benign	Het
Psmb1	A	G	17: 15,498,178	F29L	probably damaging	Het
Rab23	T	C	1: 33,723,909	V20A	probably damaging	Het
Ryr1	C	T	7: 29,116,127	A113T	probably damaging	Het
Ryr2	C	T	13: 11,790,332	R882K	probably damaging	Het
Slc6a6	A	G	6: 91,754,948	N586S	probably benign	Het
Slc9c1	A	G	16: 45,547,668	I207V	probably benign	Het
Spef2	G	A	15: 9,614,215	T1215I	probably benign	Het
Tmc7	C	T	7: 118,545,727	A537T	probably benign	Het
Tmem246	T	A	4: 49,586,412	Q252L	probably damaging	Het
Tmem70	T	C	1: 16,677,391	V243A	probably benign	Het
Top2b	T	C	14: 16,422,786	Y1408H	probably damaging	Het
Tpcn1	A	T	5: 120,539,827	F642I	probably damaging	Het
Xirp1	T	G	9: 120,018,509	D436A	probably benign	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5541:Intu	UTSW	3	40692587	splice site	probably null
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GATTGAGAGATTTTCAGAACTCACG -3'
(R):5'- AAGGTTCTCCTGCATGTTGG -3'

Sequencing Primer
(F):5'- TTTCAGAACTCACGAGTATTTGC -3'
(R):5'- TTTTGGAAGGCCCCTGCAG -3'

Posted On

2017-02-28