Incidental Mutation 'R5939:Penk'
ID462417
Institutional Source Beutler Lab
Gene Symbol Penk
Ensembl Gene ENSMUSG00000045573
Gene Namepreproenkephalin
SynonymsENK, Penk, Penk1, PPA
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5939 (G1)
Quality Score183
Status Not validated
Chromosome4
Chromosomal Location4133531-4138819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4138010 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 45 (F45S)
Ref Sequence ENSEMBL: ENSMUSP00000066822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070375] [ENSMUST00000133567]
Predicted Effect probably benign
Transcript: ENSMUST00000070375
AA Change: F45S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000066822
Gene: ENSMUSG00000045573
AA Change: F45S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Opiods_neuropep 25 70 1.5e-19 PFAM
internal_repeat_1 90 141 4.19e-10 PROSPERO
internal_repeat_1 201 267 4.19e-10 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131498
Predicted Effect probably benign
Transcript: ENSMUST00000133567
AA Change: F45S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122389
Gene: ENSMUSG00000045573
AA Change: F45S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Opiods_neuropep 25 72 3.2e-23 PFAM
Blast:CYCc 108 176 1e-16 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit nitrituria. Female homozygotes display decreased circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Penk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Penk APN 4 4134347 missense probably damaging 1.00
IGL01901:Penk APN 4 4134465 missense probably benign 0.02
IGL02634:Penk APN 4 4134065 missense possibly damaging 0.92
IGL02935:Penk APN 4 4133843 missense probably damaging 0.99
R0712:Penk UTSW 4 4134257 missense probably benign 0.35
R1126:Penk UTSW 4 4138119 missense probably benign 0.00
R1331:Penk UTSW 4 4134287 missense probably benign 0.02
R1720:Penk UTSW 4 4134240 missense probably damaging 1.00
R2181:Penk UTSW 4 4134041 splice site probably null
R3154:Penk UTSW 4 4134152 missense probably damaging 0.96
R5184:Penk UTSW 4 4134296 missense probably damaging 1.00
R5779:Penk UTSW 4 4134318 missense probably damaging 1.00
R7860:Penk UTSW 4 4133976 missense possibly damaging 0.48
Z1176:Penk UTSW 4 4138106 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGGAGATAGATACCTCAGCCC -3'
(R):5'- CCGGCAAGGTTCTCTCTAAG -3'

Sequencing Primer
(F):5'- TGGAGATAGATACCTCAGCCCTTAAG -3'
(R):5'- TCTCTAAGAGAACCTTGTCAGAGAC -3'
Posted On2017-02-28