Incidental Mutation 'R0568:Bag2'
ID46242
Institutional Source Beutler Lab
Gene Symbol Bag2
Ensembl Gene ENSMUSG00000042215
Gene NameBCL2-associated athanogene 2
Synonyms2610042A13Rik
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R0568 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33745484-33757795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33746978 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 88 (M88V)
Ref Sequence ENSEMBL: ENSMUSP00000042009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044691] [ENSMUST00000088287] [ENSMUST00000115174] [ENSMUST00000138024] [ENSMUST00000187602]
PDB Structure
Chaperone Complex [X-RAY DIFFRACTION]
Structure of the BNB domain of the Hsp70 cochaperone Bag2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000044691
AA Change: M88V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042009
Gene: ENSMUSG00000042215
AA Change: M88V

DomainStartEndE-ValueType
coiled coil region 20 60 N/A INTRINSIC
BAG 109 189 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088287
SMART Domains Protein: ENSMUSP00000085625
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115174
SMART Domains Protein: ENSMUSP00000110828
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138024
SMART Domains Protein: ENSMUSP00000137896
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
Pfam:Miro 11 59 1.9e-6 PFAM
Pfam:Ras 11 61 6.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155484
Predicted Effect unknown
Transcript: ENSMUST00000187602
AA Change: D51G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195310
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Brms1l A G 12: 55,861,388 probably null Het
C8b A G 4: 104,793,380 I462V probably benign Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in Bag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Bag2 APN 1 33746932 missense possibly damaging 0.86
R2144:Bag2 UTSW 1 33746831 missense possibly damaging 0.87
R3712:Bag2 UTSW 1 33746916 missense probably benign 0.11
R4663:Bag2 UTSW 1 33746993 missense probably damaging 1.00
R4745:Bag2 UTSW 1 33748336 splice site probably null
R4828:Bag2 UTSW 1 33746887 missense probably damaging 0.99
R4859:Bag2 UTSW 1 33746941 missense probably damaging 1.00
R4911:Bag2 UTSW 1 33748276 missense probably benign
R5643:Bag2 UTSW 1 33746953 missense probably damaging 0.99
R5644:Bag2 UTSW 1 33746953 missense probably damaging 0.99
R6899:Bag2 UTSW 1 33746831 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTCCGATGAGCAGGCACTGTAAAG -3'
(R):5'- ACTCAGGATGATCTCTGGCCCTAAC -3'

Sequencing Primer
(F):5'- CACTGTAAAGTGACATTAAGTGGCTC -3'
(R):5'- TGGCCCTAACTGTGTGAAGAC -3'
Posted On2013-06-11