Incidental Mutation 'R5939:Man1c1'
ID462420
Institutional Source Beutler Lab
Gene Symbol Man1c1
Ensembl Gene ENSMUSG00000037306
Gene Namemannosidase, alpha, class 1C, member 1
Synonyms
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134561690-134704290 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134565836 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 543 (V543M)
Ref Sequence ENSEMBL: ENSMUSP00000050979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038628] [ENSMUST00000054096]
Predicted Effect probably damaging
Transcript: ENSMUST00000038628
AA Change: V543M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037949
Gene: ENSMUSG00000037306
AA Change: V543M

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Pfam:Glyco_hydro_47 176 612 9.9e-147 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054096
AA Change: V543M

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050979
Gene: ENSMUSG00000037306
AA Change: V543M

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Pfam:Glyco_hydro_47 176 612 1.1e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185007
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Man1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Man1c1 APN 4 134564532 missense probably damaging 1.00
IGL02237:Man1c1 APN 4 134584298 critical splice donor site probably null
R0201:Man1c1 UTSW 4 134640398 splice site probably null
R0390:Man1c1 UTSW 4 134578315 missense probably damaging 1.00
R0526:Man1c1 UTSW 4 134569068 nonsense probably null
R1108:Man1c1 UTSW 4 134564613 missense probably damaging 1.00
R1518:Man1c1 UTSW 4 134580789 missense probably benign 0.01
R1756:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1866:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1914:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R1915:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2171:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2172:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R2937:Man1c1 UTSW 4 134702952 missense possibly damaging 0.72
R2938:Man1c1 UTSW 4 134702952 missense possibly damaging 0.72
R2971:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R3806:Man1c1 UTSW 4 134703351 missense probably damaging 1.00
R3977:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R3979:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4037:Man1c1 UTSW 4 134593339 missense probably damaging 1.00
R4065:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4066:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4067:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4209:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4210:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4211:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R4290:Man1c1 UTSW 4 134563785 missense probably damaging 1.00
R4431:Man1c1 UTSW 4 134703018 missense probably damaging 1.00
R4694:Man1c1 UTSW 4 134703189 missense probably benign 0.27
R4766:Man1c1 UTSW 4 134703438 missense probably damaging 1.00
R5226:Man1c1 UTSW 4 134578369 missense probably damaging 1.00
R5637:Man1c1 UTSW 4 134591424 missense probably damaging 1.00
R5677:Man1c1 UTSW 4 134569060 missense probably damaging 1.00
R7251:Man1c1 UTSW 4 134580836 missense probably damaging 1.00
R7577:Man1c1 UTSW 4 134564503 critical splice donor site probably null
X0019:Man1c1 UTSW 4 134576007 missense probably damaging 1.00
X0062:Man1c1 UTSW 4 134703372 missense possibly damaging 0.74
X0063:Man1c1 UTSW 4 134575977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTACCCTAGTCTTCTCCA -3'
(R):5'- CACAGACACCAAGCTGGG -3'

Sequencing Primer
(F):5'- AGCTCCCTGCCATGATGATAATGG -3'
(R):5'- ACCAAGCTGGGGCCTGAG -3'
Posted On2017-02-28