Mutagenetix > Incidental Mutation

Incidental Mutation 'R5939:Tpcn1'

462424

Institutional Source

Beutler Lab

Gene Symbol

Tpcn1

Ensembl Gene

ENSMUSG00000032741

Gene Name

two pore channel 1

Synonyms

5730403B01Rik

MMRRC Submission

043243-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5939 (G1)

Quality Score

176

Status

Not validated

Chromosome

Chromosomal Location

120534153-120588673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 120539827 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 642 (F642I)

Ref Sequence

ENSEMBL: ENSMUSP00000042188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046426]

AlphaFold

Q9EQJ0

Predicted Effect

probably damaging
Transcript: ENSMUST00000046426
AA Change: F642I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: F642I

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	106	332	1.5e-30	PFAM
Pfam:Ion_trans	441	695	1.2e-31	PFAM
SCOP:d1fxkc_	713	795	2e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	A	T	8: 24,914,122	F225I	probably damaging	Het
Ager	G	T	17: 34,598,201	C38F	probably damaging	Het
Arel1	C	A	12: 84,926,292	R577L	probably damaging	Het
Armh1	T	C	4: 117,229,922	Y182C	probably damaging	Het
BC005561	T	C	5: 104,519,207	Y532H	possibly damaging	Het
Cabp2	G	T	19: 4,086,470	C172F	possibly damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
D630045J12Rik	A	C	6: 38,194,969	S755A	possibly damaging	Het
Duox1	A	T	2: 122,346,351	H1451L	probably damaging	Het
Dync2h1	A	G	9: 7,037,801	V3359A	probably damaging	Het
Erlin2	T	C	8: 27,036,526	F305L	probably benign	Het
Gm10428	A	C	11: 62,753,462		probably benign	Het
Gnal	G	A	18: 67,191,385	V204M	probably damaging	Het
Intu	T	C	3: 40,692,584	V629A	probably damaging	Het
Lrguk	G	T	6: 34,078,753	C435F	probably damaging	Het
Man1c1	C	T	4: 134,565,836	V543M	probably damaging	Het
Mcm3ap	A	G	10: 76,508,361	H1779R	probably benign	Het
Neb	T	C	2: 52,257,594	T2776A	probably benign	Het
Nek10	A	T	14: 14,931,290	Y754F	possibly damaging	Het
Nr3c1	A	G	18: 39,420,653	I664T	probably benign	Het
Nrip1	T	C	16: 76,292,122	E849G	probably damaging	Het
Nrros	A	G	16: 32,143,454	F546L	probably benign	Het
Olfr1120	A	C	2: 87,357,704	I87L	possibly damaging	Het
Olfr1167	T	C	2: 88,149,509	Y170C	probably damaging	Het
Pcdhb16	A	G	18: 37,478,064	T26A	probably benign	Het
Penk	A	G	4: 4,138,010	F45S	probably benign	Het
Ppp2r3a	A	T	9: 101,212,625	N166K	probably benign	Het
Psmb1	A	G	17: 15,498,178	F29L	probably damaging	Het
Rab23	T	C	1: 33,723,909	V20A	probably damaging	Het
Ryr1	C	T	7: 29,116,127	A113T	probably damaging	Het
Ryr2	C	T	13: 11,790,332	R882K	probably damaging	Het
Slc6a6	A	G	6: 91,754,948	N586S	probably benign	Het
Slc9c1	A	G	16: 45,547,668	I207V	probably benign	Het
Spef2	G	A	15: 9,614,215	T1215I	probably benign	Het
Tmc7	C	T	7: 118,545,727	A537T	probably benign	Het
Tmem246	T	A	4: 49,586,412	Q252L	probably damaging	Het
Tmem70	T	C	1: 16,677,391	V243A	probably benign	Het
Top2b	T	C	14: 16,422,786	Y1408H	probably damaging	Het
Xirp1	T	G	9: 120,018,509	D436A	probably benign	Het

Other mutations in Tpcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Tpcn1	APN	5	120545305	missense	probably damaging	0.99
IGL00551:Tpcn1	APN	5	120560325	missense	probably benign	0.31
IGL02197:Tpcn1	APN	5	120553531	missense	probably damaging	1.00
IGL02584:Tpcn1	APN	5	120539032	missense	probably damaging	0.99
IGL03064:Tpcn1	APN	5	120537566	missense	possibly damaging	0.90
PIT1430001:Tpcn1	UTSW	5	120548323	splice site	probably benign
R0295:Tpcn1	UTSW	5	120539060	missense	probably damaging	1.00
R0316:Tpcn1	UTSW	5	120539259	missense	probably damaging	1.00
R1577:Tpcn1	UTSW	5	120544420	missense	probably damaging	1.00
R1660:Tpcn1	UTSW	5	120549515	missense	possibly damaging	0.82
R1819:Tpcn1	UTSW	5	120536227	splice site	probably null
R2051:Tpcn1	UTSW	5	120543388	missense	probably damaging	1.00
R2364:Tpcn1	UTSW	5	120553494	nonsense	probably null
R2497:Tpcn1	UTSW	5	120538998	splice site	probably null
R3965:Tpcn1	UTSW	5	120556575	missense	probably damaging	0.98
R3972:Tpcn1	UTSW	5	120553752	critical splice donor site	probably null
R4062:Tpcn1	UTSW	5	120557897	missense	possibly damaging	0.82
R4343:Tpcn1	UTSW	5	120560220	missense	probably damaging	1.00
R4422:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4423:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4424:Tpcn1	UTSW	5	120542518	missense	probably damaging	1.00
R4655:Tpcn1	UTSW	5	120539257	missense	probably damaging	0.98
R4831:Tpcn1	UTSW	5	120553489	missense	probably damaging	1.00
R4910:Tpcn1	UTSW	5	120556519	missense	probably damaging	0.98
R4948:Tpcn1	UTSW	5	120556531	missense	probably benign	0.15
R4965:Tpcn1	UTSW	5	120547487	missense	possibly damaging	0.82
R4976:Tpcn1	UTSW	5	120560322	missense	probably benign
R5071:Tpcn1	UTSW	5	120548269	critical splice donor site	probably null
R5165:Tpcn1	UTSW	5	120557945	missense	probably damaging	1.00
R5210:Tpcn1	UTSW	5	120539214	missense	probably damaging	1.00
R5910:Tpcn1	UTSW	5	120547397	intron	probably benign
R6364:Tpcn1	UTSW	5	120553810	missense	probably damaging	1.00
R6633:Tpcn1	UTSW	5	120544464	missense	probably benign	0.03
R6650:Tpcn1	UTSW	5	120537562	missense	probably null	0.50
R6885:Tpcn1	UTSW	5	120544437	missense	probably benign	0.21
R7038:Tpcn1	UTSW	5	120585277	missense	probably damaging	0.99
R7247:Tpcn1	UTSW	5	120585250	missense	possibly damaging	0.63
R7594:Tpcn1	UTSW	5	120556530	missense	possibly damaging	0.67
R7629:Tpcn1	UTSW	5	120537937	missense	probably benign	0.00
R7854:Tpcn1	UTSW	5	120549588	missense	probably damaging	1.00
R8478:Tpcn1	UTSW	5	120560321	missense	probably benign
R8967:Tpcn1	UTSW	5	120555958	missense	probably damaging	0.98
R8970:Tpcn1	UTSW	5	120544453	missense	probably damaging	1.00
R9137:Tpcn1	UTSW	5	120557925	missense	probably damaging	1.00
R9158:Tpcn1	UTSW	5	120549923	splice site	probably benign
R9179:Tpcn1	UTSW	5	120541950	missense	probably damaging	1.00
R9180:Tpcn1	UTSW	5	120555935	missense	probably benign	0.00
R9241:Tpcn1	UTSW	5	120553493	missense	probably benign	0.01
R9341:Tpcn1	UTSW	5	120540672	missense	possibly damaging	0.81
R9343:Tpcn1	UTSW	5	120540672	missense	possibly damaging	0.81
R9502:Tpcn1	UTSW	5	120560325	missense	probably benign	0.19
R9594:Tpcn1	UTSW	5	120547956	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGCTGACAACAACGGGTTC -3'
(R):5'- TGGCCTCTCCTCAATACCAG -3'

Sequencing Primer
(F):5'- TGGCACACTGCTGACCAATAGTC -3'
(R):5'- TACCAGCCTTAGCCTGAGATAG -3'

Posted On

2017-02-28