Incidental Mutation 'R5939:Tpcn1'
ID462424
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5939 (G1)
Quality Score176
Status Not validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120539827 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 642 (F642I)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably damaging
Transcript: ENSMUST00000046426
AA Change: F642I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: F642I

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGACAACAACGGGTTC -3'
(R):5'- TGGCCTCTCCTCAATACCAG -3'

Sequencing Primer
(F):5'- TGGCACACTGCTGACCAATAGTC -3'
(R):5'- TACCAGCCTTAGCCTGAGATAG -3'
Posted On2017-02-28