Incidental Mutation 'R5939:Lrguk'
ID462425
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Nameleucine-rich repeats and guanylate kinase domain containing
Synonyms4921528H16Rik
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5939 (G1)
Quality Score221
Status Not validated
Chromosome6
Chromosomal Location34029448-34134034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34078753 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 435 (C435F)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: C435F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: C435F

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228187
AA Change: C435F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34043429 missense probably damaging 1.00
IGL00566:Lrguk APN 6 34056174 missense probably damaging 1.00
IGL01720:Lrguk APN 6 34043477 missense probably damaging 1.00
IGL02325:Lrguk APN 6 34129179 missense probably benign 0.31
IGL02484:Lrguk APN 6 34092791 missense probably damaging 1.00
IGL02493:Lrguk APN 6 34129192 missense probably benign 0.03
IGL02636:Lrguk APN 6 34090188 missense probably damaging 1.00
IGL03278:Lrguk APN 6 34116446 missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34043496 missense probably damaging 0.99
R1069:Lrguk UTSW 6 34048883 missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34062360 missense probably benign 0.01
R1568:Lrguk UTSW 6 34086438 missense probably damaging 1.00
R1604:Lrguk UTSW 6 34072370 missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34133387 missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34071068 missense probably damaging 1.00
R2107:Lrguk UTSW 6 34062361 missense probably benign 0.15
R2125:Lrguk UTSW 6 34092902 missense probably benign 0.05
R2136:Lrguk UTSW 6 34043519 missense probably benign 0.00
R2997:Lrguk UTSW 6 34073762 missense probably damaging 0.98
R3847:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R3849:Lrguk UTSW 6 34073768 missense probably damaging 1.00
R4626:Lrguk UTSW 6 34129223 missense probably benign 0.00
R4718:Lrguk UTSW 6 34029496 missense probably benign 0.02
R4778:Lrguk UTSW 6 34056080 missense probably damaging 1.00
R4841:Lrguk UTSW 6 34092867 missense probably damaging 0.98
R5324:Lrguk UTSW 6 34073797 missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34071061 missense probably damaging 1.00
R5741:Lrguk UTSW 6 34048867 missense probably damaging 0.99
R5997:Lrguk UTSW 6 34129143 missense probably damaging 0.99
R6786:Lrguk UTSW 6 34095587 missense probably benign 0.11
R6802:Lrguk UTSW 6 34062457 missense probably damaging 1.00
R7081:Lrguk UTSW 6 34102139 missense probably benign 0.01
R7303:Lrguk UTSW 6 34029476 missense probably benign 0.00
R7316:Lrguk UTSW 6 34103256 missense unknown
R7473:Lrguk UTSW 6 34029695 missense probably benign 0.01
R7543:Lrguk UTSW 6 34048935 nonsense probably null
R7613:Lrguk UTSW 6 34101748 missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34095539 missense probably damaging 1.00
R7900:Lrguk UTSW 6 34129194 missense probably benign 0.01
R8012:Lrguk UTSW 6 34056103 missense probably benign 0.00
R8251:Lrguk UTSW 6 34116439 missense probably benign 0.00
R8324:Lrguk UTSW 6 34102571 missense probably benign 0.03
X0057:Lrguk UTSW 6 34078747 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GCAAGTGCTCATTAGTTATGACTG -3'
(R):5'- CTTGTGAGAACTTGTCATCTACCTAAC -3'

Sequencing Primer
(F):5'- GTGATGTAGAAACTTTACCTTGTGC -3'
(R):5'- GAACTTGTCATCTACCTAACTTTCAC -3'
Posted On2017-02-28