Incidental Mutation 'R5939:Slc6a6'
ID 462427
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Name solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms Taut
MMRRC Submission 043243-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5939 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 91661031-91736044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91731929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 586 (N586S)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
AlphaFold O35316
Predicted Effect probably benign
Transcript: ENSMUST00000032185
AA Change: N586S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: N586S

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206988
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 25,404,138 (GRCm39) F225I probably damaging Het
Ager G T 17: 34,817,175 (GRCm39) C38F probably damaging Het
Arel1 C A 12: 84,973,066 (GRCm39) R577L probably damaging Het
Armh1 T C 4: 117,087,119 (GRCm39) Y182C probably damaging Het
Cabp2 G T 19: 4,136,470 (GRCm39) C172F possibly damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
D630045J12Rik A C 6: 38,171,904 (GRCm39) S755A possibly damaging Het
Duox1 A T 2: 122,176,832 (GRCm39) H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 (GRCm39) V3359A probably damaging Het
Erlin2 T C 8: 27,526,554 (GRCm39) F305L probably benign Het
Gm10428 A C 11: 62,644,288 (GRCm39) probably benign Het
Gnal G A 18: 67,324,456 (GRCm39) V204M probably damaging Het
Intu T C 3: 40,647,014 (GRCm39) V629A probably damaging Het
Lrguk G T 6: 34,055,688 (GRCm39) C435F probably damaging Het
Man1c1 C T 4: 134,293,147 (GRCm39) V543M probably damaging Het
Mcm3ap A G 10: 76,344,195 (GRCm39) H1779R probably benign Het
Neb T C 2: 52,147,606 (GRCm39) T2776A probably benign Het
Nek10 A T 14: 14,931,290 (GRCm38) Y754F possibly damaging Het
Nr3c1 A G 18: 39,553,706 (GRCm39) I664T probably benign Het
Nrip1 T C 16: 76,089,010 (GRCm39) E849G probably damaging Het
Nrros A G 16: 31,962,272 (GRCm39) F546L probably benign Het
Or12e8 A C 2: 87,188,048 (GRCm39) I87L possibly damaging Het
Or5d39 T C 2: 87,979,853 (GRCm39) Y170C probably damaging Het
Pcdhb16 A G 18: 37,611,117 (GRCm39) T26A probably benign Het
Penk A G 4: 4,138,010 (GRCm39) F45S probably benign Het
Pgap4 T A 4: 49,586,412 (GRCm39) Q252L probably damaging Het
Ppp2r3d A T 9: 101,089,824 (GRCm39) N166K probably benign Het
Psmb1 A G 17: 15,718,440 (GRCm39) F29L probably damaging Het
Rab23 T C 1: 33,762,990 (GRCm39) V20A probably damaging Het
Ryr1 C T 7: 28,815,552 (GRCm39) A113T probably damaging Het
Ryr2 C T 13: 11,805,218 (GRCm39) R882K probably damaging Het
Slc9c1 A G 16: 45,368,031 (GRCm39) I207V probably benign Het
Spef2 G A 15: 9,614,301 (GRCm39) T1215I probably benign Het
Thoc2l T C 5: 104,667,073 (GRCm39) Y532H possibly damaging Het
Tmc7 C T 7: 118,144,950 (GRCm39) A537T probably benign Het
Tmem70 T C 1: 16,747,615 (GRCm39) V243A probably benign Het
Top2b T C 14: 16,422,786 (GRCm38) Y1408H probably damaging Het
Tpcn1 A T 5: 120,677,892 (GRCm39) F642I probably damaging Het
Xirp1 T G 9: 119,847,575 (GRCm39) D436A probably benign Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91,718,151 (GRCm39) intron probably benign
IGL01829:Slc6a6 APN 6 91,712,170 (GRCm39) missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91,703,050 (GRCm39) missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91,712,160 (GRCm39) missense probably benign
IGL02301:Slc6a6 APN 6 91,703,037 (GRCm39) missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91,726,808 (GRCm39) missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91,725,311 (GRCm39) unclassified probably benign
animas UTSW 6 91,716,995 (GRCm39) splice site probably null
customary UTSW 6 91,703,224 (GRCm39) nonsense probably null
durango UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
habit UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R5861_Slc6a6_905 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6665_Slc6a6_931 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R0530:Slc6a6 UTSW 6 91,701,939 (GRCm39) missense probably null 0.04
R1327:Slc6a6 UTSW 6 91,703,016 (GRCm39) missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91,717,973 (GRCm39) missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91,718,008 (GRCm39) missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91,701,891 (GRCm39) missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91,712,161 (GRCm39) missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91,703,177 (GRCm39) missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91,712,193 (GRCm39) missense probably benign 0.33
R2656:Slc6a6 UTSW 6 91,718,029 (GRCm39) missense probably damaging 1.00
R3402:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3403:Slc6a6 UTSW 6 91,703,110 (GRCm39) missense probably benign
R3978:Slc6a6 UTSW 6 91,732,033 (GRCm39) missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91,718,257 (GRCm39) missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91,700,452 (GRCm39) missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91,703,041 (GRCm39) missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91,712,155 (GRCm39) missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91,712,170 (GRCm39) missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91,721,981 (GRCm39) missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91,700,298 (GRCm39) missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91,718,014 (GRCm39) missense probably damaging 1.00
R6160:Slc6a6 UTSW 6 91,716,995 (GRCm39) splice site probably null
R6262:Slc6a6 UTSW 6 91,732,013 (GRCm39) missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91,731,896 (GRCm39) missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91,703,020 (GRCm39) missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91,729,419 (GRCm39) missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91,718,248 (GRCm39) missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91,701,832 (GRCm39) missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91,716,946 (GRCm39) missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91,718,226 (GRCm39) missense probably benign 0.11
R8125:Slc6a6 UTSW 6 91,703,087 (GRCm39) missense probably damaging 0.97
R8194:Slc6a6 UTSW 6 91,717,952 (GRCm39) missense probably damaging 1.00
R8239:Slc6a6 UTSW 6 91,701,951 (GRCm39) missense probably benign 0.00
R8343:Slc6a6 UTSW 6 91,703,224 (GRCm39) nonsense probably null
R8363:Slc6a6 UTSW 6 91,727,277 (GRCm39) missense probably benign 0.03
R8836:Slc6a6 UTSW 6 91,725,444 (GRCm39) missense probably damaging 0.96
R9102:Slc6a6 UTSW 6 91,731,940 (GRCm39) missense probably benign 0.10
R9257:Slc6a6 UTSW 6 91,716,952 (GRCm39) missense possibly damaging 0.74
R9511:Slc6a6 UTSW 6 91,721,921 (GRCm39) missense probably damaging 1.00
R9526:Slc6a6 UTSW 6 91,726,808 (GRCm39) missense probably benign 0.02
R9701:Slc6a6 UTSW 6 91,700,478 (GRCm39) missense probably damaging 1.00
X0002:Slc6a6 UTSW 6 91,700,457 (GRCm39) missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91,718,205 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGTCATGTGTGTACCC -3'
(R):5'- TCTGTAAACCTGGTCCTATGAGAATC -3'

Sequencing Primer
(F):5'- TGTACCCTGTCTGTAAGCAAG -3'
(R):5'- CCTGGTCCTATGAGAATCTAACG -3'
Posted On 2017-02-28