Incidental Mutation 'R5939:Tmc7'
ID462429
Institutional Source Beutler Lab
Gene Symbol Tmc7
Ensembl Gene ENSMUSG00000042246
Gene Nametransmembrane channel-like gene family 7
Synonyms
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location118535841-118584736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118545727 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 537 (A537T)
Ref Sequence ENSEMBL: ENSMUSP00000046927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044195]
Predicted Effect probably benign
Transcript: ENSMUST00000044195
AA Change: A537T

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046927
Gene: ENSMUSG00000042246
AA Change: A537T

DomainStartEndE-ValueType
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 216 238 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 402 424 N/A INTRINSIC
Pfam:TMC 484 595 5.2e-51 PFAM
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153635
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Tmc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Tmc7 APN 7 118552762 missense probably damaging 1.00
IGL01456:Tmc7 APN 7 118547310 splice site probably benign
IGL01784:Tmc7 APN 7 118547315 critical splice donor site probably null
IGL02158:Tmc7 APN 7 118538211 missense probably damaging 1.00
PIT4403001:Tmc7 UTSW 7 118547400 missense probably benign 0.04
PIT4403001:Tmc7 UTSW 7 118547401 missense possibly damaging 0.86
PIT4696001:Tmc7 UTSW 7 118564343 missense probably benign 0.04
R1164:Tmc7 UTSW 7 118542024 missense probably benign 0.01
R1169:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1170:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1420:Tmc7 UTSW 7 118566217 nonsense probably null
R1885:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1886:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1887:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1923:Tmc7 UTSW 7 118545627 missense probably benign 0.08
R2220:Tmc7 UTSW 7 118552816 missense possibly damaging 0.87
R4858:Tmc7 UTSW 7 118543342 missense probably damaging 1.00
R5000:Tmc7 UTSW 7 118558854 critical splice donor site probably null
R5038:Tmc7 UTSW 7 118543365 missense probably damaging 1.00
R5075:Tmc7 UTSW 7 118552696 critical splice donor site probably null
R5272:Tmc7 UTSW 7 118561053 missense probably benign
R5691:Tmc7 UTSW 7 118541893 missense probably benign
R5800:Tmc7 UTSW 7 118539440 missense probably benign
R5889:Tmc7 UTSW 7 118566326 missense probably benign 0.00
R6251:Tmc7 UTSW 7 118561038 missense possibly damaging 0.83
R6642:Tmc7 UTSW 7 118545611 nonsense probably null
R6644:Tmc7 UTSW 7 118538162 missense probably benign
R6814:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6872:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6967:Tmc7 UTSW 7 118547678 missense probably benign 0.00
R7165:Tmc7 UTSW 7 118555934 missense probably benign 0.00
R7492:Tmc7 UTSW 7 118541966 missense probably benign 0.00
R7543:Tmc7 UTSW 7 118545756 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCCTGTCCACAGCACAGC -3'
(R):5'- CTGCGTGCACAACCATGT -3'

Sequencing Primer
(F):5'- CAGCAAAAACCGGAGCTATAG -3'
(R):5'- TGCACAACCATGTACACACTC -3'
Posted On2017-02-28