Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Copa'

46243

Institutional Source

Beutler Lab

Gene Symbol

Copa

Ensembl Gene

ENSMUSG00000026553

Gene Name

coatomer protein complex subunit alpha

Synonyms

xenin

MMRRC Submission

038759-MU

Accession Numbers

Genbank: NM_009938; MGI: 1334462

Is this an essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172082529-172122330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 172112137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 624 (V624A)

Ref Sequence

ENSEMBL: ENSMUSP00000027833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000124289] [ENSMUST00000135192]

AlphaFold

Q8CIE6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027833
AA Change: V624A

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: V624A

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	776	5.4e-144	PFAM
Pfam:COPI_C	824	1233	1.4e-190	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122845

Predicted Effect

probably benign
Transcript: ENSMUST00000124289

SMART Domains

Protein: ENSMUSP00000118899
Gene: ENSMUSG00000026553

Domain	Start	End	E-Value	Type
Blast:WD40	1	37	2e-19	BLAST
PDB:4J8G\|B	1	52	2e-23	PDB
SCOP:d1erja_	1	52	1e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133909

Predicted Effect

possibly damaging
Transcript: ENSMUST00000135192
AA Change: V615A

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: V615A

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	767	1.1e-148	PFAM
Pfam:COPI_C	815	1224	3.6e-216	PFAM

Meta Mutation Damage Score

0.3362

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Copa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Copa	APN	1	172110688	missense	possibly damaging	0.87
IGL01360:Copa	APN	1	172087588	splice site	probably null
IGL01434:Copa	APN	1	172119561	missense	probably benign	0.00
IGL01744:Copa	APN	1	172113189	missense	probably benign	0.01
IGL01837:Copa	APN	1	172118852	missense	probably benign	0.01
IGL01988:Copa	APN	1	172118264	missense	probably benign	0.09
IGL02059:Copa	APN	1	172099753	missense	probably damaging	0.96
IGL02123:Copa	APN	1	172112128	missense	probably damaging	1.00
IGL02731:Copa	APN	1	172102218	missense	possibly damaging	0.77
IGL03114:Copa	APN	1	172119268	nonsense	probably null
P0027:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
PIT4434001:Copa	UTSW	1	172106175	missense	probably benign	0.00
R0233:Copa	UTSW	1	172087667	critical splice donor site	probably null
R0465:Copa	UTSW	1	172118305	missense	probably damaging	1.00
R0547:Copa	UTSW	1	172121687	splice site	probably benign
R0628:Copa	UTSW	1	172091025	splice site	probably benign
R1328:Copa	UTSW	1	172121691	splice site	probably benign
R1494:Copa	UTSW	1	172104127	missense	probably benign	0.27
R1728:Copa	UTSW	1	172111987	missense	probably benign
R1758:Copa	UTSW	1	172104144	missense	probably damaging	1.00
R1784:Copa	UTSW	1	172111987	missense	probably benign
R1942:Copa	UTSW	1	172111888	missense	probably damaging	1.00
R2054:Copa	UTSW	1	172118957	nonsense	probably null
R2299:Copa	UTSW	1	172121725	missense	probably benign	0.10
R2518:Copa	UTSW	1	172119901	missense	probably benign
R2680:Copa	UTSW	1	172121404	nonsense	probably null
R3080:Copa	UTSW	1	172113149	missense	probably damaging	1.00
R3160:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3161:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3973:Copa	UTSW	1	172121245	missense	probably benign	0.00
R3975:Copa	UTSW	1	172121245	missense	probably benign	0.00
R4031:Copa	UTSW	1	172108375	missense	probably damaging	1.00
R4155:Copa	UTSW	1	172101425	missense	probably damaging	1.00
R4227:Copa	UTSW	1	172118115	intron	probably benign
R4244:Copa	UTSW	1	172110718	missense	probably benign	0.00
R4254:Copa	UTSW	1	172102244	missense	probably damaging	1.00
R4291:Copa	UTSW	1	172092397	intron	probably benign
R4323:Copa	UTSW	1	172119264	missense	probably damaging	1.00
R4402:Copa	UTSW	1	172102224	missense	probably damaging	1.00
R4711:Copa	UTSW	1	172119988	missense	probably damaging	1.00
R4721:Copa	UTSW	1	172104274	splice site	probably benign
R4773:Copa	UTSW	1	172105220	missense	probably damaging	1.00
R4794:Copa	UTSW	1	172119321	missense	probably damaging	1.00
R4887:Copa	UTSW	1	172092276	missense	probably benign	0.39
R4953:Copa	UTSW	1	172082886	unclassified	probably benign
R5139:Copa	UTSW	1	172121329	missense	probably damaging	0.99
R5152:Copa	UTSW	1	172118061	missense	probably benign	0.34
R5297:Copa	UTSW	1	172113108	missense	probably damaging	1.00
R5586:Copa	UTSW	1	172105222	missense	probably damaging	1.00
R5698:Copa	UTSW	1	172118944	nonsense	probably null
R6283:Copa	UTSW	1	172118848	missense	possibly damaging	0.79
R6921:Copa	UTSW	1	172111924	missense	possibly damaging	0.63
R6934:Copa	UTSW	1	172110686	missense	possibly damaging	0.64
R7009:Copa	UTSW	1	172091000	missense	probably damaging	0.96
R7194:Copa	UTSW	1	172119944	missense	probably damaging	0.99
R7348:Copa	UTSW	1	172102223	missense	possibly damaging	0.96
R7710:Copa	UTSW	1	172109844	missense	possibly damaging	0.50
R7745:Copa	UTSW	1	172111942	missense	probably damaging	1.00
R7893:Copa	UTSW	1	172119565	nonsense	probably null
R8168:Copa	UTSW	1	172099672	missense	probably damaging	1.00
R8273:Copa	UTSW	1	172118979	critical splice donor site	probably null
R8704:Copa	UTSW	1	172104126	missense	probably benign	0.01
R8754:Copa	UTSW	1	172108359	missense	probably damaging	1.00
R8757:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8759:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8885:Copa	UTSW	1	172097745	missense	probably damaging	1.00
R8891:Copa	UTSW	1	172119251	missense	probably damaging	1.00
R8927:Copa	UTSW	1	172104170	missense	probably null	0.03
R8928:Copa	UTSW	1	172104170	missense	probably null	0.03
R8956:Copa	UTSW	1	172109913	missense	possibly damaging	0.65
R9063:Copa	UTSW	1	172116962	missense	probably benign	0.00
R9295:Copa	UTSW	1	172112256	missense	probably damaging	0.99
R9364:Copa	UTSW	1	172117264	missense	probably benign	0.00
R9437:Copa	UTSW	1	172104145	missense	possibly damaging	0.93
T0722:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
Z1177:Copa	UTSW	1	172106123	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGCCTAGACAGAGAGTGTCGTC -3'
(R):5'- ACATTAGGTTACGCTGGTCCCGAG -3'

Sequencing Primer
(F):5'- CCTCGGGTGCTAACCATTG -3'
(R):5'- CTGGTCCCGAGCCTTCC -3'

Posted On

2013-06-11