Mutagenetix > Incidental Mutations

Incidental Mutation 'R5939:Adam32'

462430

Institutional Source

Beutler Lab

Gene Symbol

Adam32

Ensembl Gene

ENSMUSG00000037437

Gene Name

a disintegrin and metallopeptidase domain 32

Synonyms

MMRRC Submission

043243-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5939 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24836140-24948804 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24914122 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 225 (F225I)

Ref Sequence

ENSEMBL: ENSMUSP00000113627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438]

Predicted Effect

probably damaging
Transcript: ENSMUST00000119720
AA Change: F225I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437
AA Change: F225I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	145	4.5e-32	PFAM
Pfam:Reprolysin	187	384	4.1e-66	PFAM
Pfam:Reprolysin_3	211	318	6.2e-7	PFAM
DISIN	400	481	2.69e-16	SMART
ACR	482	622	6.83e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121438
AA Change: F225I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: F225I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Pep_M12B_propep	24	145	8.4e-26	PFAM
Pfam:Reprolysin	187	384	1.3e-68	PFAM
DISIN	400	481	2.69e-16	SMART
ACR	482	622	6.83e-38	SMART
EGF	631	660	1.73e0	SMART
transmembrane domain	689	711	N/A	INTRINSIC
low complexity region	719	754	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174059

SMART Domains

Protein: ENSMUSP00000134680
Gene: ENSMUSG00000037437

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Pep_M12B_propep	19	141	4.6e-27	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ager	G	T	17: 34,598,201	C38F	probably damaging	Het
Arel1	C	A	12: 84,926,292	R577L	probably damaging	Het
Armh1	T	C	4: 117,229,922	Y182C	probably damaging	Het
BC005561	T	C	5: 104,519,207	Y532H	possibly damaging	Het
Cabp2	G	T	19: 4,086,470	C172F	possibly damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
D630045J12Rik	A	C	6: 38,194,969	S755A	possibly damaging	Het
Duox1	A	T	2: 122,346,351	H1451L	probably damaging	Het
Dync2h1	A	G	9: 7,037,801	V3359A	probably damaging	Het
Erlin2	T	C	8: 27,036,526	F305L	probably benign	Het
Gm10428	A	C	11: 62,753,462		probably benign	Het
Gnal	G	A	18: 67,191,385	V204M	probably damaging	Het
Intu	T	C	3: 40,692,584	V629A	probably damaging	Het
Lrguk	G	T	6: 34,078,753	C435F	probably damaging	Het
Man1c1	C	T	4: 134,565,836	V543M	probably damaging	Het
Mcm3ap	A	G	10: 76,508,361	H1779R	probably benign	Het
Neb	T	C	2: 52,257,594	T2776A	probably benign	Het
Nek10	A	T	14: 14,931,290	Y754F	possibly damaging	Het
Nr3c1	A	G	18: 39,420,653	I664T	probably benign	Het
Nrip1	T	C	16: 76,292,122	E849G	probably damaging	Het
Nrros	A	G	16: 32,143,454	F546L	probably benign	Het
Olfr1120	A	C	2: 87,357,704	I87L	possibly damaging	Het
Olfr1167	T	C	2: 88,149,509	Y170C	probably damaging	Het
Pcdhb16	A	G	18: 37,478,064	T26A	probably benign	Het
Penk	A	G	4: 4,138,010	F45S	probably benign	Het
Ppp2r3a	A	T	9: 101,212,625	N166K	probably benign	Het
Psmb1	A	G	17: 15,498,178	F29L	probably damaging	Het
Rab23	T	C	1: 33,723,909	V20A	probably damaging	Het
Ryr1	C	T	7: 29,116,127	A113T	probably damaging	Het
Ryr2	C	T	13: 11,790,332	R882K	probably damaging	Het
Slc6a6	A	G	6: 91,754,948	N586S	probably benign	Het
Slc9c1	A	G	16: 45,547,668	I207V	probably benign	Het
Spef2	G	A	15: 9,614,215	T1215I	probably benign	Het
Tmc7	C	T	7: 118,545,727	A537T	probably benign	Het
Tmem246	T	A	4: 49,586,412	Q252L	probably damaging	Het
Tmem70	T	C	1: 16,677,391	V243A	probably benign	Het
Top2b	T	C	14: 16,422,786	Y1408H	probably damaging	Het
Tpcn1	A	T	5: 120,539,827	F642I	probably damaging	Het
Xirp1	T	G	9: 120,018,509	D436A	probably benign	Het

Other mutations in Adam32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00775:Adam32	APN	8	24921354	missense	probably damaging	1.00
IGL00793:Adam32	APN	8	24837830	splice site	probably benign
IGL01317:Adam32	APN	8	24872581	missense	probably damaging	1.00
IGL01475:Adam32	APN	8	24872648	missense	probably damaging	1.00
IGL01501:Adam32	APN	8	24914353	missense	probably damaging	1.00
IGL01659:Adam32	APN	8	24870774	splice site	probably benign
IGL01994:Adam32	APN	8	24902796	splice site	probably benign
IGL02137:Adam32	APN	8	24872594	missense	probably damaging	1.00
IGL02393:Adam32	APN	8	24920053	missense	probably damaging	1.00
IGL02516:Adam32	APN	8	24898596	missense	probably damaging	1.00
IGL02892:Adam32	APN	8	24878711	intron	probably benign
IGL02929:Adam32	APN	8	24872643	missense	possibly damaging	0.81
IGL03273:Adam32	APN	8	24921340	missense	probably damaging	1.00
PIT4515001:Adam32	UTSW	8	24914326	missense	possibly damaging	0.88
R0088:Adam32	UTSW	8	24914067	missense	probably damaging	1.00
R0098:Adam32	UTSW	8	24914389	missense	possibly damaging	0.79
R0098:Adam32	UTSW	8	24914389	missense	possibly damaging	0.79
R0189:Adam32	UTSW	8	24922337	critical splice acceptor site	probably null
R1740:Adam32	UTSW	8	24921298	missense	probably damaging	1.00
R1853:Adam32	UTSW	8	24898626	missense	probably benign	0.02
R2090:Adam32	UTSW	8	24901440	critical splice donor site	probably null
R2906:Adam32	UTSW	8	24863504	missense	probably damaging	1.00
R2907:Adam32	UTSW	8	24863504	missense	probably damaging	1.00
R4304:Adam32	UTSW	8	24901529	missense	probably damaging	1.00
R4612:Adam32	UTSW	8	24872736	missense	probably damaging	1.00
R4673:Adam32	UTSW	8	24884455	missense	probably damaging	1.00
R4786:Adam32	UTSW	8	24863493	missense	probably damaging	1.00
R5292:Adam32	UTSW	8	24864451	missense	possibly damaging	0.85
R5398:Adam32	UTSW	8	24872579	missense	possibly damaging	0.95
R5524:Adam32	UTSW	8	24922312	missense	probably damaging	0.99
R6350:Adam32	UTSW	8	24863429	missense	possibly damaging	0.86
R6766:Adam32	UTSW	8	24872630	missense	probably damaging	0.96
R6893:Adam32	UTSW	8	24878754	missense	probably damaging	1.00
R7095:Adam32	UTSW	8	24914070	missense	probably damaging	1.00
R7241:Adam32	UTSW	8	24898494	missense	probably benign	0.00
R7457:Adam32	UTSW	8	24884619	missense	probably damaging	0.98
R7864:Adam32	UTSW	8	24922276	missense	probably benign	0.11
R8083:Adam32	UTSW	8	24872736	missense	probably damaging	1.00
R8248:Adam32	UTSW	8	24901470	missense	possibly damaging	0.93
R8376:Adam32	UTSW	8	24919920	missense	possibly damaging	0.81
Z1176:Adam32	UTSW	8	24948750	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGGATTAAGCTATAGCATGTGTC -3'
(R):5'- TGATTACTTGGGCTCTGACAG -3'

Sequencing Primer
(F):5'- AGCTATAGCATGTGTCTTATGTTTTC -3'
(R):5'- CATGAGTATAAACAGAGTGTGG -3'

Posted On

2017-02-28