Incidental Mutation 'R5939:Erlin2'
ID462431
Institutional Source Beutler Lab
Gene Symbol Erlin2
Ensembl Gene ENSMUSG00000031483
Gene NameER lipid raft associated 2
SynonymsSpfh2
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5939 (G1)
Quality Score223
Status Not validated
Chromosome8
Chromosomal Location27023261-27040328 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27036526 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 305 (F305L)
Ref Sequence ENSEMBL: ENSMUSP00000033873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033873] [ENSMUST00000209520] [ENSMUST00000209563] [ENSMUST00000209795] [ENSMUST00000211043] [ENSMUST00000211233]
Predicted Effect probably benign
Transcript: ENSMUST00000033873
AA Change: F305L

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033873
Gene: ENSMUSG00000031483
AA Change: F305L

DomainStartEndE-ValueType
PHB 21 187 1.62e-36 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209504
AA Change: F222L
Predicted Effect probably benign
Transcript: ENSMUST00000209520
Predicted Effect probably benign
Transcript: ENSMUST00000209563
Predicted Effect probably benign
Transcript: ENSMUST00000209795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210445
Predicted Effect probably benign
Transcript: ENSMUST00000211043
Predicted Effect probably benign
Transcript: ENSMUST00000211233
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPFH domain-containing family of lipid raft-associated proteins. The encoded protein is localized to lipid rafts of the endoplasmic reticulum and plays a critical role in inositol 1,4,5-trisphosphate (IP3) signaling by mediating ER-associated degradation of activated IP3 receptors. Mutations in this gene are a cause of spastic paraplegia-18 (SPG18). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Erlin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Erlin2 APN 8 27036548 missense probably benign
IGL01534:Erlin2 APN 8 27031957 nonsense probably null
IGL02719:Erlin2 APN 8 27029675 unclassified probably benign
R0193:Erlin2 UTSW 8 27031764 missense possibly damaging 0.82
R4479:Erlin2 UTSW 8 27025099 missense probably benign 0.02
R4878:Erlin2 UTSW 8 27027166 splice site probably null
R4965:Erlin2 UTSW 8 27029595 missense probably damaging 0.99
R5082:Erlin2 UTSW 8 27033407 missense probably damaging 0.98
R6172:Erlin2 UTSW 8 27036095 critical splice donor site probably null
R6705:Erlin2 UTSW 8 27036440 missense probably damaging 1.00
R7033:Erlin2 UTSW 8 27031764 missense probably benign 0.03
R7537:Erlin2 UTSW 8 27031772 critical splice donor site probably null
R8161:Erlin2 UTSW 8 27028942 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAACACATGTCTGCTTGAC -3'
(R):5'- AGAGGTCAAATCTACGGTGC -3'

Sequencing Primer
(F):5'- TTGACAGATGCCCTCCCCAG -3'
(R):5'- GAGGTCAAATCTACGGTGCATACAC -3'
Posted On2017-02-28