Incidental Mutation 'R5939:Ppp2r3a'
ID462435
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
Synonyms
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101212625 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 166 (N166K)
Ref Sequence ENSEMBL: ENSMUSP00000075327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075941]
Predicted Effect probably benign
Transcript: ENSMUST00000075941
AA Change: N166K

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: N166K

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191226
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4480001:Ppp2r3a UTSW 9 101126377 missense possibly damaging 0.95
PIT4687001:Ppp2r3a UTSW 9 101144380 missense probably benign 0.00
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1086:Ppp2r3a UTSW 9 101153822 missense possibly damaging 0.67
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6574:Ppp2r3a UTSW 9 101194385 missense probably benign 0.03
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7189:Ppp2r3a UTSW 9 101126422 missense possibly damaging 0.59
R7190:Ppp2r3a UTSW 9 101212527 missense probably benign 0.11
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
R7512:Ppp2r3a UTSW 9 101175333 missense possibly damaging 0.69
R7655:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
R7656:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Z1176:Ppp2r3a UTSW 9 101126389 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCATTTCAGTAAGATGTCCAAGC -3'
(R):5'- CCTGTAACTTAAAGGACATTGCAGG -3'

Sequencing Primer
(F):5'- GCACATTTTTATGTCTGTCCCAGAAG -3'
(R):5'- CTTAAAGGACATTGCAGGAGAAGC -3'
Posted On2017-02-28