Incidental Mutation 'R5939:Xirp1'
ID462438
Institutional Source Beutler Lab
Gene Symbol Xirp1
Ensembl Gene ENSMUSG00000079243
Gene Namexin actin-binding repeat containing 1
SynonymsCmya1, Xin, mXin alpha
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.433) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location120013755-120023598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120018509 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 436 (D436A)
Ref Sequence ENSEMBL: ENSMUSP00000107262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111635] [ENSMUST00000177637] [ENSMUST00000213113]
Predicted Effect probably benign
Transcript: ENSMUST00000111635
AA Change: D436A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000107262
Gene: ENSMUSG00000079243
AA Change: D436A

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 69 81 N/A INTRINSIC
Pfam:Xin 89 104 1.7e-9 PFAM
Pfam:Xin 151 166 2.1e-9 PFAM
Pfam:Xin 186 201 1.6e-9 PFAM
Pfam:Xin 266 279 4.8e-9 PFAM
Pfam:Xin 303 317 1.1e-10 PFAM
Pfam:Xin 341 355 5.6e-8 PFAM
Pfam:Xin 376 391 6.7e-11 PFAM
Pfam:Xin 511 526 1.5e-12 PFAM
Pfam:Xin 549 563 2.6e-11 PFAM
Pfam:Xin 593 607 5.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213113
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice exhibit cardiac hypertrophy and a disruption of cardiac intercalated disc structure and myofilament abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Other mutations in Xirp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Xirp1 APN 9 120017919 missense probably damaging 1.00
IGL02105:Xirp1 APN 9 120016997 missense probably damaging 1.00
IGL03365:Xirp1 APN 9 120018539 missense probably damaging 0.99
cornflower UTSW 9 120019815 start codon destroyed probably null 0.89
R0006:Xirp1 UTSW 9 120017454 missense probably benign 0.01
R0320:Xirp1 UTSW 9 120016467 missense probably benign 0.00
R0881:Xirp1 UTSW 9 120018417 missense possibly damaging 0.69
R1220:Xirp1 UTSW 9 120017916 missense possibly damaging 0.95
R1707:Xirp1 UTSW 9 120018775 missense possibly damaging 0.53
R1783:Xirp1 UTSW 9 120016907 missense probably benign
R1785:Xirp1 UTSW 9 120016907 missense probably benign
R1978:Xirp1 UTSW 9 120018591 missense probably benign 0.00
R1983:Xirp1 UTSW 9 120016629 nonsense probably null
R2064:Xirp1 UTSW 9 120016896 missense probably benign 0.00
R2860:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2860:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120019815 start codon destroyed probably null 0.89
R2861:Xirp1 UTSW 9 120018378 missense probably benign 0.04
R2919:Xirp1 UTSW 9 120018701 missense possibly damaging 0.81
R3013:Xirp1 UTSW 9 120019785 missense probably benign
R3704:Xirp1 UTSW 9 120016907 missense probably benign 0.04
R3898:Xirp1 UTSW 9 120019340 missense probably benign 0.00
R3981:Xirp1 UTSW 9 120017744 missense probably damaging 0.98
R4609:Xirp1 UTSW 9 120016506 missense probably benign
R4613:Xirp1 UTSW 9 120019682 missense probably damaging 1.00
R4660:Xirp1 UTSW 9 120016992 missense probably damaging 1.00
R4703:Xirp1 UTSW 9 120017027 missense probably damaging 1.00
R4825:Xirp1 UTSW 9 120017003 missense possibly damaging 0.77
R4993:Xirp1 UTSW 9 120018792 missense probably damaging 1.00
R5297:Xirp1 UTSW 9 120019602 missense probably damaging 1.00
R6091:Xirp1 UTSW 9 120017963 missense probably benign 0.01
R6290:Xirp1 UTSW 9 120018725 missense probably benign
R6376:Xirp1 UTSW 9 120018491 missense probably damaging 1.00
R6515:Xirp1 UTSW 9 120016917 missense probably benign 0.00
R6616:Xirp1 UTSW 9 120019014 missense probably damaging 0.98
R6976:Xirp1 UTSW 9 120017918 missense probably damaging 1.00
R7165:Xirp1 UTSW 9 120019047 missense probably damaging 1.00
R7471:Xirp1 UTSW 9 120019110 nonsense probably null
R7744:Xirp1 UTSW 9 120016846 missense possibly damaging 0.77
R7847:Xirp1 UTSW 9 120019753 missense possibly damaging 0.92
R8010:Xirp1 UTSW 9 120017824 missense probably benign 0.00
R8371:Xirp1 UTSW 9 120019433 missense possibly damaging 0.78
V8831:Xirp1 UTSW 9 120016907 missense probably benign
X0025:Xirp1 UTSW 9 120019155 missense probably damaging 1.00
Z1088:Xirp1 UTSW 9 120016907 missense probably benign
Z1176:Xirp1 UTSW 9 120016880 missense probably damaging 0.96
Z1176:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120016907 missense probably benign
Z1177:Xirp1 UTSW 9 120017154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCATAGCATATACCGGGG -3'
(R):5'- GTTCCCTGGACACTCTGAAG -3'

Sequencing Primer
(F):5'- CATAGCATATACCGGGGCGTCAG -3'
(R):5'- CCACCCAAGGAGGAGGTGATTC -3'
Posted On2017-02-28