Incidental Mutation 'R5939:Gm10428'
ID462441
Institutional Source Beutler Lab
Gene Symbol Gm10428
Ensembl Gene ENSMUSG00000096083
Gene Namepredicted gene 10428
Synonyms
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location62753100-62753498 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to C at 62753462 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147022 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138105
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175753
Predicted Effect unknown
Transcript: ENSMUST00000178750
AA Change: R121S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207474
Predicted Effect probably benign
Transcript: ENSMUST00000207597
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Gm10428
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0630:Gm10428 UTSW 11 62753430 utr 3 prime probably benign
R1925:Gm10428 UTSW 11 62753353 utr 3 prime probably benign
R5466:Gm10428 UTSW 11 62753106 utr 3 prime probably benign
R5761:Gm10428 UTSW 11 62753343 utr 3 prime probably benign
R5788:Gm10428 UTSW 11 62753281 utr 3 prime probably benign
R6611:Gm10428 UTSW 11 62753289 utr 3 prime probably benign
R7115:Gm10428 UTSW 11 62753380 missense unknown
R8398:Gm10428 UTSW 11 62753347 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACATGTGCCTACATCTATAGGG -3'
(R):5'- GCTATCAGAGAACGGCTTTGG -3'

Sequencing Primer
(F):5'- CCTCAAAATAAATGATGAAGTCTGCC -3'
(R):5'- CGGCTTTGGAAAAGATTTATCACAG -3'
Posted On2017-02-28