Incidental Mutation 'R5939:Top2b'
ID462445
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16422786 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1408 (Y1408H)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably damaging
Transcript: ENSMUST00000017629
AA Change: Y1408H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: Y1408H

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161693
AA Change: Y282H
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485
AA Change: Y282H

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224695
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5035:Top2b UTSW 14 16409966 missense probably benign 0.01
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
X0028:Top2b UTSW 14 16384499 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTTTCTTCTTAGCTGAAAGACC -3'
(R):5'- CAGGAGCTGTCCAAATACACTC -3'

Sequencing Primer
(F):5'- TCTTAGCTGAAAGACCTAAGTACAC -3'
(R):5'- CTGTCCAAATACACTCCATGTAGATG -3'
Posted On2017-02-28