Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Tprn'

46245

Institutional Source

Beutler Lab

Gene Symbol

Tprn

Ensembl Gene

ENSMUSG00000048707

Gene Name

taperin

Synonyms

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25262618-25269885 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25264321 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 545 (V545A)

Ref Sequence

ENSEMBL: ENSMUSP00000109975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114336]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114336
AA Change: V545A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707
AA Change: V545A

Domain	Start	End	E-Value	Type
Pfam:Phostensin_N	8	89	8.3e-38	PFAM
low complexity region	105	117	N/A	INTRINSIC
internal_repeat_1	149	273	1.71e-5	PROSPERO
low complexity region	290	322	N/A	INTRINSIC
low complexity region	401	410	N/A	INTRINSIC
Pfam:Phostensin	506	645	1.8e-65	PFAM
low complexity region	647	665	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137361

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141509

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155738

Meta Mutation Damage Score

0.4429

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sensory epithelial protein. It was defined by linkage analysis in three Pakistani families to lie between D9S1818 (centromeric) and D9SH6 (telomeric). Mutations at this locus have been associated with autosomal recessive deafness. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss and degeneration of hair cell stereocilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Tprn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03072:Tprn	APN	2	25264518	missense	probably damaging	1.00
IGL03139:Tprn	APN	2	25264054	missense	probably benign	0.31
R0615:Tprn	UTSW	2	25264198	missense	probably damaging	0.97
R0706:Tprn	UTSW	2	25264491	missense	probably damaging	1.00
R1675:Tprn	UTSW	2	25264409	missense	probably benign	0.01
R2508:Tprn	UTSW	2	25268928	missense	possibly damaging	0.95
R4257:Tprn	UTSW	2	25264482	missense	probably damaging	1.00
R4493:Tprn	UTSW	2	25268892	missense	probably damaging	1.00
R4494:Tprn	UTSW	2	25268892	missense	probably damaging	1.00
R4898:Tprn	UTSW	2	25268833	missense	probably damaging	0.99
R5536:Tprn	UTSW	2	25263357	missense	probably benign	0.07
R5537:Tprn	UTSW	2	25263357	missense	probably benign	0.07
R6753:Tprn	UTSW	2	25264038	missense	probably benign
R7554:Tprn	UTSW	2	25263799	missense	probably damaging	1.00
R7887:Tprn	UTSW	2	25264012	missense	probably damaging	0.97
X0003:Tprn	UTSW	2	25268911	unclassified	probably benign
X0010:Tprn	UTSW	2	25268911	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAGGACTTCCAGTCACCTTCATTG -3'
(R):5'- TTACGGAGAAGACCTCCATGCCAG -3'

Sequencing Primer
(F):5'- TTGATGAAGTAGACTCAGAGGAGG -3'
(R):5'- CGAGGAGCCAGCTTTGATG -3'

Posted On

2013-06-11