Incidental Mutation 'R5939:Psmb1'
ID462451
Institutional Source Beutler Lab
Gene Symbol Psmb1
Ensembl Gene ENSMUSG00000014769
Gene Nameproteasome (prosome, macropain) subunit, beta type 1
SynonymsLmpc5
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location15475021-15499751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15498178 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 29 (F29L)
Ref Sequence ENSEMBL: ENSMUSP00000156355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014911] [ENSMUST00000014913] [ENSMUST00000117593] [ENSMUST00000118001] [ENSMUST00000119879] [ENSMUST00000143924] [ENSMUST00000147081] [ENSMUST00000155051] [ENSMUST00000159197] [ENSMUST00000162505] [ENSMUST00000231341] [ENSMUST00000232500]
Predicted Effect probably benign
Transcript: ENSMUST00000014911
SMART Domains Protein: ENSMUSP00000014911
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 4.3e-34 PFAM
Pfam:TBP 227 313 3.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000014913
AA Change: F29L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014913
Gene: ENSMUSG00000014769
AA Change: F29L

DomainStartEndE-ValueType
Pfam:Proteasome 33 225 8.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117593
SMART Domains Protein: ENSMUSP00000112794
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 4.3e-34 PFAM
Pfam:TBP 227 313 3.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118001
SMART Domains Protein: ENSMUSP00000113999
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 204 1.4e-29 PFAM
Pfam:TBP 203 257 4.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119879
SMART Domains Protein: ENSMUSP00000114007
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 222 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143924
SMART Domains Protein: ENSMUSP00000122696
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147081
SMART Domains Protein: ENSMUSP00000120484
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 138 178 9.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155051
SMART Domains Protein: ENSMUSP00000117551
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159197
SMART Domains Protein: ENSMUSP00000125691
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162505
SMART Domains Protein: ENSMUSP00000124317
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 139 221 1.1e-34 PFAM
Pfam:TBP 229 312 8.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231341
AA Change: F29L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232661
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Psmb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Psmb1 APN 17 15490284 start codon destroyed probably null 0.21
R0416:Psmb1 UTSW 17 15494519 missense probably benign 0.00
R3908:Psmb1 UTSW 17 15490281 missense probably damaging 1.00
R4946:Psmb1 UTSW 17 15498216 missense probably benign 0.01
R4976:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R4979:Psmb1 UTSW 17 15476189 missense probably benign 0.23
R5119:Psmb1 UTSW 17 15498262 start codon destroyed probably null 0.99
R5506:Psmb1 UTSW 17 15490216 missense probably damaging 1.00
R6848:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7178:Psmb1 UTSW 17 15477259 missense possibly damaging 0.50
R7701:Psmb1 UTSW 17 15477247 missense probably benign 0.03
R7891:Psmb1 UTSW 17 15494486 missense probably benign 0.01
R7974:Psmb1 UTSW 17 15494486 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAACGTGTTCAAGCCCTAC -3'
(R):5'- TCCAAGAGCAACGACGAGTG -3'

Sequencing Primer
(F):5'- CGTGTTCAAGCCCTACCAAAC -3'
(R):5'- CGACGAGTGCAGGCTAG -3'
Posted On2017-02-28