Incidental Mutation 'R5939:Ager'
ID462452
Institutional Source Beutler Lab
Gene Symbol Ager
Ensembl Gene ENSMUSG00000015452
Gene Nameadvanced glycosylation end product-specific receptor
SynonymsRAGE
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34597862-34600936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34598201 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 38 (C38F)
Ref Sequence ENSEMBL: ENSMUSP00000134401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015596] [ENSMUST00000015622] [ENSMUST00000038149] [ENSMUST00000173328] [ENSMUST00000173992] [ENSMUST00000174069] [ENSMUST00000174496] [ENSMUST00000174532] [ENSMUST00000183827]
Predicted Effect probably damaging
Transcript: ENSMUST00000015596
AA Change: C38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015596
Gene: ENSMUSG00000015452
AA Change: C38F

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 4.3e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015622
SMART Domains Protein: ENSMUSP00000015622
Gene: ENSMUSG00000015478

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
RING 27 67 1.5e-8 SMART
transmembrane domain 118 140 N/A INTRINSIC
transmembrane domain 160 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038149
SMART Domains Protein: ENSMUSP00000040464
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:PBC 50 243 1.3e-97 PFAM
HOX 244 309 1.9e-18 SMART
low complexity region 327 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172932
SMART Domains Protein: ENSMUSP00000133660
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173229
Predicted Effect probably benign
Transcript: ENSMUST00000173328
SMART Domains Protein: ENSMUSP00000133766
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 161 5e-84 PFAM
HOX 162 227 1.9e-18 SMART
low complexity region 245 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173589
SMART Domains Protein: ENSMUSP00000133845
Gene: ENSMUSG00000015452

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173992
AA Change: C38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134579
Gene: ENSMUSG00000015452
AA Change: C38F

DomainStartEndE-ValueType
IG 23 108 3.23e-7 SMART
Pfam:C2-set_2 114 208 3.3e-24 PFAM
IGc2 239 297 7.63e-18 SMART
transmembrane domain 321 343 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174069
AA Change: C38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133391
Gene: ENSMUSG00000015452
AA Change: C38F

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 2.5e-24 PFAM
IGc2 248 306 7.63e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174496
AA Change: C38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134401
Gene: ENSMUSG00000015452
AA Change: C38F

DomainStartEndE-ValueType
IG 23 117 2.44e-7 SMART
Pfam:C2-set_2 123 217 3.4e-24 PFAM
IGc2 248 306 7.63e-18 SMART
transmembrane domain 330 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174475
Predicted Effect probably benign
Transcript: ENSMUST00000174532
SMART Domains Protein: ENSMUSP00000133744
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 148 3.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183827
SMART Domains Protein: ENSMUSP00000139079
Gene: ENSMUSG00000034673

DomainStartEndE-ValueType
Pfam:PBC 1 183 9.5e-98 PFAM
HOX 184 249 1.9e-18 SMART
low complexity region 267 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The advanced glycosylation end product (AGE) receptor encoded by this gene is a member of the immunoglobulin superfamily of cell surface receptors. It is a multiligand receptor, and besides AGE, interacts with other molecules implicated in homeostasis, development, and inflammation, and certain diseases, such as diabetes and Alzheimer's disease. Many alternatively spliced transcript variants encoding different isoforms, as well as non-protein-coding variants, have been described for this gene (PMID:18089847). [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for a null allele show increased bone mass and strength, reduced osteoclast number, abnormal blood vessel healing, and altered development of nephropathy and pain perception in induced diabetes. Homozygotes for another null allele show restored diabetes-induced angiogenic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Ager
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01808:Ager APN 17 34599457 missense probably damaging 0.97
IGL02143:Ager APN 17 34599118 missense probably damaging 1.00
IGL02219:Ager APN 17 34600120 missense probably damaging 0.97
R1337:Ager UTSW 17 34600622 critical splice donor site probably null
R1584:Ager UTSW 17 34600718 missense probably damaging 1.00
R2269:Ager UTSW 17 34599150 missense probably damaging 1.00
R5804:Ager UTSW 17 34598183 missense probably damaging 0.98
R5881:Ager UTSW 17 34600077 missense probably damaging 1.00
R6276:Ager UTSW 17 34598754 missense possibly damaging 0.86
R6551:Ager UTSW 17 34599468 unclassified probably null
R7009:Ager UTSW 17 34600736 missense probably damaging 1.00
R8212:Ager UTSW 17 34600612 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTGCTCTATGGGGTGAGACAC -3'
(R):5'- CTTCCTGTGTTCTGTGAAGAAGAG -3'

Sequencing Primer
(F):5'- CTAGAAATCCCCCTGAACCTGGG -3'
(R):5'- TGTGTTCTGTGAAGAAGAGAAAAACC -3'
Posted On2017-02-28