Incidental Mutation 'R5939:Nr3c1'
ID462454
Institutional Source Beutler Lab
Gene Symbol Nr3c1
Ensembl Gene ENSMUSG00000024431
Gene Namenuclear receptor subfamily 3, group C, member 1
SynonymsGrl-1, GR, Grl1, glucocorticoid receptor
MMRRC Submission 043243-MU
Accession Numbers

Genbank: NM_008173

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location39410545-39491301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39420653 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 664 (I664T)
Ref Sequence ENSEMBL: ENSMUSP00000111233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025300] [ENSMUST00000097592] [ENSMUST00000115567] [ENSMUST00000115571] [ENSMUST00000152853]
Predicted Effect probably benign
Transcript: ENSMUST00000025300
AA Change: I664T

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025300
Gene: ENSMUSG00000024431
AA Change: I664T

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097592
AA Change: I665T

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095199
Gene: ENSMUSG00000024431
AA Change: I665T

DomainStartEndE-ValueType
Pfam:GCR 27 86 9.2e-16 PFAM
Pfam:GCR 75 418 1.4e-161 PFAM
ZnF_C4 434 506 8.6e-35 SMART
HOLI 581 745 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115567
AA Change: I664T

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111229
Gene: ENSMUSG00000024431
AA Change: I664T

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115571
AA Change: I664T

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111233
Gene: ENSMUSG00000024431
AA Change: I664T

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152853
SMART Domains Protein: ENSMUSP00000120082
Gene: ENSMUSG00000024431

DomainStartEndE-ValueType
Pfam:GCR 27 418 5.7e-167 PFAM
ZnF_C4 434 488 5.65e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die at birth of respiratory failure with underdeveloped lungs, enlarged adrenals, elevated serum corticosterone and ACTH, and failed adrenaline synthesis. Mice with a point mutation have impaired gluconeogenesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(3) Targeted, other(8) Gene trapped(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Gnal G A 18: 67,191,385 V204M probably damaging Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Nr3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nr3c1 APN 18 39428608 splice site probably null
IGL00798:Nr3c1 APN 18 39486871 missense probably damaging 1.00
IGL01527:Nr3c1 APN 18 39486637 missense probably benign 0.00
IGL02088:Nr3c1 APN 18 39424391 missense probably damaging 1.00
IGL02244:Nr3c1 APN 18 39421557 unclassified probably benign
IGL03145:Nr3c1 APN 18 39486260 missense probably damaging 1.00
IGL03236:Nr3c1 APN 18 39486391 missense probably benign 0.00
3-1:Nr3c1 UTSW 18 39486039 missense probably benign
R1296:Nr3c1 UTSW 18 39486998 nonsense probably null
R2251:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2253:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2922:Nr3c1 UTSW 18 39487103 missense possibly damaging 0.93
R4667:Nr3c1 UTSW 18 39428727 missense probably benign 0.22
R4971:Nr3c1 UTSW 18 39486877 missense probably damaging 1.00
R5106:Nr3c1 UTSW 18 39486601 missense possibly damaging 0.80
R5732:Nr3c1 UTSW 18 39415699 missense probably damaging 1.00
R5976:Nr3c1 UTSW 18 39421549 missense probably damaging 1.00
R6091:Nr3c1 UTSW 18 39486958 small deletion probably benign
R6666:Nr3c1 UTSW 18 39487147 missense probably damaging 1.00
R7073:Nr3c1 UTSW 18 39486396 missense probably benign 0.00
R7286:Nr3c1 UTSW 18 39486460 small insertion probably benign
R7289:Nr3c1 UTSW 18 39414601 missense probably benign 0.37
R7289:Nr3c1 UTSW 18 39422733 missense probably benign 0.03
R7334:Nr3c1 UTSW 18 39487037 missense probably benign 0.00
X0019:Nr3c1 UTSW 18 39487142 missense probably damaging 0.96
X0062:Nr3c1 UTSW 18 39428792 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTCATCACCAGAGATC -3'
(R):5'- TAGCAGTAGGTATGTTTGCAGCC -3'

Sequencing Primer
(F):5'- AGAGATCCCTGGGCAGATC -3'
(R):5'- CAGTAGGTATGTTTGCAGCCATGAC -3'
Posted On2017-02-28