Incidental Mutation 'R5939:Gnal'
ID462455
Institutional Source Beutler Lab
Gene Symbol Gnal
Ensembl Gene ENSMUSG00000024524
Gene Nameguanine nucleotide binding protein, alpha stimulating, olfactory type
SynonymsGna10, 9630020G10Rik, Galphaolf, 2610011C15Rik, Golf, G alpha 10
MMRRC Submission 043243-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R5939 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67088336-67226792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67191385 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 204 (V204M)
Ref Sequence ENSEMBL: ENSMUSP00000025402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402] [ENSMUST00000076605]
Predicted Effect probably damaging
Transcript: ENSMUST00000025402
AA Change: V204M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524
AA Change: V204M

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076605
AA Change: V137M

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075908
Gene: ENSMUSG00000024524
AA Change: V137M

DomainStartEndE-ValueType
G_alpha 22 380 5.02e-176 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous for a targeted mutation fail to feed, and ~75% die within 2 days after birth. Rare survivors reach sexual maturity and mate but are hyperactive and anosmic, exhibitng severely reduced odor-evoked electrophysical responses and significantly perturbed maternal behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 A T 8: 24,914,122 F225I probably damaging Het
Ager G T 17: 34,598,201 C38F probably damaging Het
Arel1 C A 12: 84,926,292 R577L probably damaging Het
Armh1 T C 4: 117,229,922 Y182C probably damaging Het
BC005561 T C 5: 104,519,207 Y532H possibly damaging Het
Cabp2 G T 19: 4,086,470 C172F possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
D630045J12Rik A C 6: 38,194,969 S755A possibly damaging Het
Duox1 A T 2: 122,346,351 H1451L probably damaging Het
Dync2h1 A G 9: 7,037,801 V3359A probably damaging Het
Erlin2 T C 8: 27,036,526 F305L probably benign Het
Gm10428 A C 11: 62,753,462 probably benign Het
Intu T C 3: 40,692,584 V629A probably damaging Het
Lrguk G T 6: 34,078,753 C435F probably damaging Het
Man1c1 C T 4: 134,565,836 V543M probably damaging Het
Mcm3ap A G 10: 76,508,361 H1779R probably benign Het
Neb T C 2: 52,257,594 T2776A probably benign Het
Nek10 A T 14: 14,931,290 Y754F possibly damaging Het
Nr3c1 A G 18: 39,420,653 I664T probably benign Het
Nrip1 T C 16: 76,292,122 E849G probably damaging Het
Nrros A G 16: 32,143,454 F546L probably benign Het
Olfr1120 A C 2: 87,357,704 I87L possibly damaging Het
Olfr1167 T C 2: 88,149,509 Y170C probably damaging Het
Pcdhb16 A G 18: 37,478,064 T26A probably benign Het
Penk A G 4: 4,138,010 F45S probably benign Het
Ppp2r3a A T 9: 101,212,625 N166K probably benign Het
Psmb1 A G 17: 15,498,178 F29L probably damaging Het
Rab23 T C 1: 33,723,909 V20A probably damaging Het
Ryr1 C T 7: 29,116,127 A113T probably damaging Het
Ryr2 C T 13: 11,790,332 R882K probably damaging Het
Slc6a6 A G 6: 91,754,948 N586S probably benign Het
Slc9c1 A G 16: 45,547,668 I207V probably benign Het
Spef2 G A 15: 9,614,215 T1215I probably benign Het
Tmc7 C T 7: 118,545,727 A537T probably benign Het
Tmem246 T A 4: 49,586,412 Q252L probably damaging Het
Tmem70 T C 1: 16,677,391 V243A probably benign Het
Top2b T C 14: 16,422,786 Y1408H probably damaging Het
Tpcn1 A T 5: 120,539,827 F642I probably damaging Het
Xirp1 T G 9: 120,018,509 D436A probably benign Het
Other mutations in Gnal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gnal APN 18 67134289 splice site probably null
IGL01290:Gnal APN 18 67211098 missense probably damaging 1.00
IGL02097:Gnal APN 18 67217208 splice site probably benign
IGL02519:Gnal APN 18 67088765 missense unknown
IGL02691:Gnal APN 18 67222675 missense probably damaging 1.00
R0455:Gnal UTSW 18 67135649 splice site probably benign
R0506:Gnal UTSW 18 67088673 missense unknown
R2107:Gnal UTSW 18 67213578 missense probably damaging 1.00
R3937:Gnal UTSW 18 67135370 splice site probably null
R4246:Gnal UTSW 18 67088583 missense unknown
R4247:Gnal UTSW 18 67088583 missense unknown
R4299:Gnal UTSW 18 67088583 missense unknown
R4343:Gnal UTSW 18 67135588 missense probably benign 0.29
R5309:Gnal UTSW 18 67213107 missense possibly damaging 0.49
R5579:Gnal UTSW 18 67088771 missense unknown
R6277:Gnal UTSW 18 67213072 missense probably damaging 1.00
R7031:Gnal UTSW 18 67222588 missense probably damaging 0.99
R7142:Gnal UTSW 18 67218528 missense probably damaging 1.00
R7343:Gnal UTSW 18 67135525 missense probably benign 0.03
R7366:Gnal UTSW 18 67211071 missense possibly damaging 0.58
R7806:Gnal UTSW 18 67213074 missense probably damaging 1.00
R8269:Gnal UTSW 18 67135622 missense possibly damaging 0.87
Z1088:Gnal UTSW 18 67191403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACCCTGCCTTGTATCATG -3'
(R):5'- AATGTTGCCAAAACCTCCTCTTTAG -3'

Sequencing Primer
(F):5'- GCCTTGTATCATGCTGAATCATG -3'
(R):5'- AGTCAAAGTTACTCTTGATTTCTGC -3'
Posted On2017-02-28