Mutagenetix > Incidental Mutations

Incidental Mutation 'R5940:Usf1'

462461

Institutional Source

Beutler Lab

Gene Symbol

Usf1

Ensembl Gene

ENSMUSG00000026641

Gene Name

upstream transcription factor 1

Synonyms

bHLHb11, upstream stimulatory factor

MMRRC Submission

044132-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.668) question?

Stock #

R5940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

171411313-171419142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 171417779 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 253 (E253G)

Ref Sequence

ENSEMBL: ENSMUSP00000128913 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546] [ENSMUST00000171362]

Predicted Effect

probably benign
Transcript: ENSMUST00000001284

Predicted Effect

probably benign
Transcript: ENSMUST00000159207

SMART Domains

Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

Domain	Start	End	E-Value	Type
low complexity region	121	145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159371

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159929

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160335

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160486
AA Change: E253G

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641
AA Change: E253G

Domain	Start	End	E-Value	Type
low complexity region	121	145	N/A	INTRINSIC
HLH	205	260	5.01e-15	SMART
low complexity region	265	281	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161241
AA Change: E253G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641
AA Change: E253G

Domain	Start	End	E-Value	Type
low complexity region	121	145	N/A	INTRINSIC
HLH	205	260	5.01e-15	SMART
low complexity region	265	281	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161297

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167546
AA Change: E253G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641
AA Change: E253G

Domain	Start	End	E-Value	Type
low complexity region	121	145	N/A	INTRINSIC
HLH	205	260	5.01e-15	SMART
low complexity region	265	281	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171362

SMART Domains

Protein: ENSMUSP00000132771
Gene: ENSMUSG00000103711

Domain	Start	End	E-Value	Type
RHOD	25	133	2.05e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193060

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194029

Meta Mutation Damage Score

0.5106

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

96% (88/92)

MGI Phenotype

FUNCTION: This protein encoded by this gene is a member of the basic-Helix-Hoop-Helix-Leucine zipper (bHLH-LZ) family and encodes a protein that can act as a transcription factor. Studies indicate that the basic region interacts with DNA at E-Box motifs, while the helix-loop-helix and leucine zipper domains are involved in dimerization with different partners. This protein is involved in a wide array of biological pathways, including cell cycle regulation, immune response, and responses to ultraviolet radiation. Mice lacking most of the coding exons of this gene often lacked both whiskers and nasal fur, and were prone to epileptic seizures, while mice lacking both this gene and another family member, Usf2, displayed embryonic lethality (PMID:9520440). Mutations in the human ortholog of this gene have been associated with Familial Combined Hyperlipidemia (FCHL) in humans. Pseudogenes of this gene are found on chromosome 11 and the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mutants exhibit slight behavioral abnormalities. Females exhibit barbering and some have seizures. This knockout mutation (heterozygous or homozygous) acts as an enhancer of a null mutation of Usf2, resulting in embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	A	G	4: 107,893,288		probably benign	Het
1110008L16Rik	T	A	12: 55,304,874	W323R	probably damaging	Het
1500015O10Rik	C	T	1: 43,737,241	R41*	probably null	Het
3425401B19Rik	T	C	14: 32,662,688	Y440C	possibly damaging	Het
5430419D17Rik	A	T	7: 131,238,263	D638V	probably damaging	Het
Aasdh	G	T	5: 76,882,898	S618R	probably benign	Het
Alpk1	T	G	3: 127,670,946	T1228P	probably benign	Het
Ank3	T	C	10: 69,920,486	V850A	probably benign	Het
Apeh	A	T	9: 108,091,899		probably null	Het
Ash1l	C	T	3: 88,984,036	T1074I	probably damaging	Het
C3	G	A	17: 57,210,244	S1297F	possibly damaging	Het
Cchcr1	G	A	17: 35,524,993	R284Q	probably damaging	Het
Cd93	A	T	2: 148,442,232	I398N	probably benign	Het
Chrd	G	T	16: 20,734,586	R226L	probably null	Het
Clvs1	A	T	4: 9,449,443	N344I	possibly damaging	Het
Cyp4v3	A	T	8: 45,321,784	I111N	probably damaging	Het
Cysltr2	T	C	14: 73,029,491	K260E	probably benign	Het
Cysltr2	T	A	14: 73,029,949	Y107F	probably damaging	Het
Defb47	A	T	14: 63,000,910	E28D	probably benign	Het
Dnajc30	T	A	5: 135,064,559	Y103*	probably null	Het
Drap1	T	C	19: 5,423,000	T160A	probably benign	Het
Dsp	A	G	13: 38,196,026	E2249G	possibly damaging	Het
E2f8	T	A	7: 48,871,077	I499F	probably benign	Het
Ebf1	T	A	11: 44,621,221	Y116N	probably damaging	Het
Ect2	C	A	3: 27,115,465	E746D	probably benign	Het
Enpep	T	A	3: 129,312,578	Y333F	probably damaging	Het
Fat4	T	C	3: 38,889,649	V897A	probably benign	Het
Gja3	T	A	14: 57,035,860	S352C	probably damaging	Het
Gm884	T	C	11: 103,613,886	S243G	probably benign	Het
Gpr153	C	A	4: 152,283,375	P561Q	probably benign	Het
Hlcs	T	C	16: 94,134,712	M574V	probably damaging	Het
Hmcn1	A	G	1: 150,657,222	V3070A	probably benign	Het
Hsd3b2	G	T	3: 98,711,971	N219K	probably benign	Het
Htra3	T	C	5: 35,652,980	I453V	possibly damaging	Het
Klrc1	A	T	6: 129,674,935	M220K	possibly damaging	Het
Kntc1	T	G	5: 123,786,195	I1048S	probably benign	Het
Macf1	T	A	4: 123,432,881	D2822V	probably damaging	Het
Mcu	T	A	10: 59,456,732	I42F	possibly damaging	Het
Mkln1	T	A	6: 31,489,372	D521E	probably damaging	Het
Ms4a13	T	C	19: 11,192,966	N5D	possibly damaging	Het
Msh3	T	G	13: 92,249,843	N838T	probably damaging	Het
Msl2	T	A	9: 101,101,091	C221*	probably null	Het
Ncapd2	A	G	6: 125,168,869	S1310P	probably benign	Het
Ncoa6	A	T	2: 155,415,865	M586K	probably damaging	Het
Ndel1	C	T	11: 68,822,571		probably benign	Het
Ndst4	T	C	3: 125,561,419		probably benign	Het
Nes	T	G	3: 87,975,952	V506G	probably damaging	Het
Nrg1	T	C	8: 31,849,344	K200E	probably damaging	Het
Nt5c1b	A	G	12: 10,375,515	K295E	probably damaging	Het
Olfr1085	A	T	2: 86,658,050	M136K	probably damaging	Het
Olfr1278	G	A	2: 111,292,384	V39M	possibly damaging	Het
Olfr1487	T	A	19: 13,619,153		probably null	Het
Olfr750	T	A	14: 51,070,722	I224L	probably damaging	Het
Olfr878	C	T	9: 37,919,437	T260I	probably damaging	Het
Olfr919	G	T	9: 38,697,711	Y218*	probably null	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pde1a	A	G	2: 79,887,839		probably null	Het
Pds5a	A	G	5: 65,643,985		probably benign	Het
Plbd1	A	T	6: 136,613,721		probably benign	Het
Plod2	T	A	9: 92,591,397	V292E	probably benign	Het
Polg	A	G	7: 79,454,071	V879A	possibly damaging	Het
Ppargc1a	C	T	5: 51,473,911	A459T	probably damaging	Het
Psip1	T	C	4: 83,476,322	E83G	probably damaging	Het
Rhbdf1	T	C	11: 32,209,847	D843G	probably benign	Het
Rnpepl1	G	T	1: 92,917,712	C451F	probably damaging	Het
Rrp1	T	C	10: 78,405,415	D206G	probably damaging	Het
Setbp1	A	T	18: 78,755,488	D1492E	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc16a6	C	T	11: 109,473,196		probably benign	Homo
Slc7a6os	A	G	8: 106,210,805	S37P	probably damaging	Het
Tenm4	T	A	7: 96,845,895	S1140T	probably damaging	Het
Thoc6	C	A	17: 23,670,341	R115L	probably benign	Het
Tmem63c	C	T	12: 87,075,172	H385Y	probably benign	Het
Trpm8	G	T	1: 88,351,415	E649*	probably null	Het
Vps13d	T	C	4: 145,074,975	T443A	probably benign	Het
Wdr86	T	C	5: 24,722,662	Y93C	probably damaging	Het
Zfp597	A	T	16: 3,865,821	I357N	probably damaging	Het
Zfp709	A	G	8: 71,890,220	I497V	possibly damaging	Het
Zxdc	T	C	6: 90,370,325	S223P	probably damaging	Het

Other mutations in Usf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Usf1	APN	1	171417275	missense	probably damaging	0.98
IGL01658:Usf1	APN	1	171417299	missense	possibly damaging	0.93
IGL01921:Usf1	APN	1	171416856	missense	possibly damaging	0.94
IGL02307:Usf1	APN	1	171415746	missense	probably damaging	0.99
R0661:Usf1	UTSW	1	171417499	missense	probably damaging	0.97
R1075:Usf1	UTSW	1	171418109	missense	probably benign	0.22
R1652:Usf1	UTSW	1	171417749	missense	probably damaging	1.00
R2272:Usf1	UTSW	1	171418060	missense	possibly damaging	0.60
R4697:Usf1	UTSW	1	171416964	missense	possibly damaging	0.55
R4999:Usf1	UTSW	1	171415763	missense	probably damaging	0.98
R7430:Usf1	UTSW	1	171417727	missense	probably benign
R7863:Usf1	UTSW	1	171417817	nonsense	probably null
R7866:Usf1	UTSW	1	171417894	missense	unknown
R7946:Usf1	UTSW	1	171417817	nonsense	probably null
R7949:Usf1	UTSW	1	171417894	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TAACGAAGGTAGGTGGCATCC -3'
(R):5'- CAATGGCAAGTGTTTTCCAGGG -3'

Sequencing Primer
(F):5'- TGGCATCCAGGTGTGAAGC -3'
(R):5'- AGTGTTTTCCAGGGACTCCAAAC -3'

Posted On

2017-02-28