Incidental Mutation 'R5940:Alpk1'
ID462473
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Namealpha-kinase 1
Synonyms8430410J10Rik
MMRRC Submission 044132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5940 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location127670310-127780527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127670946 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1228 (T1228P)
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
Predicted Effect probably benign
Transcript: ENSMUST00000029662
AA Change: T1228P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: T1228P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect probably benign
Transcript: ENSMUST00000198955
AA Change: T1228P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: T1228P

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,893,288 probably benign Het
1110008L16Rik T A 12: 55,304,874 W323R probably damaging Het
1500015O10Rik C T 1: 43,737,241 R41* probably null Het
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
5430419D17Rik A T 7: 131,238,263 D638V probably damaging Het
Aasdh G T 5: 76,882,898 S618R probably benign Het
Ank3 T C 10: 69,920,486 V850A probably benign Het
Apeh A T 9: 108,091,899 probably null Het
Ash1l C T 3: 88,984,036 T1074I probably damaging Het
C3 G A 17: 57,210,244 S1297F possibly damaging Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cd93 A T 2: 148,442,232 I398N probably benign Het
Chrd G T 16: 20,734,586 R226L probably null Het
Clvs1 A T 4: 9,449,443 N344I possibly damaging Het
Cyp4v3 A T 8: 45,321,784 I111N probably damaging Het
Cysltr2 T A 14: 73,029,949 Y107F probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Defb47 A T 14: 63,000,910 E28D probably benign Het
Dnajc30 T A 5: 135,064,559 Y103* probably null Het
Drap1 T C 19: 5,423,000 T160A probably benign Het
Dsp A G 13: 38,196,026 E2249G possibly damaging Het
E2f8 T A 7: 48,871,077 I499F probably benign Het
Ebf1 T A 11: 44,621,221 Y116N probably damaging Het
Ect2 C A 3: 27,115,465 E746D probably benign Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Fat4 T C 3: 38,889,649 V897A probably benign Het
Gja3 T A 14: 57,035,860 S352C probably damaging Het
Gm884 T C 11: 103,613,886 S243G probably benign Het
Gpr153 C A 4: 152,283,375 P561Q probably benign Het
Hlcs T C 16: 94,134,712 M574V probably damaging Het
Hmcn1 A G 1: 150,657,222 V3070A probably benign Het
Hsd3b2 G T 3: 98,711,971 N219K probably benign Het
Htra3 T C 5: 35,652,980 I453V possibly damaging Het
Klrc1 A T 6: 129,674,935 M220K possibly damaging Het
Kntc1 T G 5: 123,786,195 I1048S probably benign Het
Macf1 T A 4: 123,432,881 D2822V probably damaging Het
Mcu T A 10: 59,456,732 I42F possibly damaging Het
Mkln1 T A 6: 31,489,372 D521E probably damaging Het
Ms4a13 T C 19: 11,192,966 N5D possibly damaging Het
Msh3 T G 13: 92,249,843 N838T probably damaging Het
Msl2 T A 9: 101,101,091 C221* probably null Het
Ncapd2 A G 6: 125,168,869 S1310P probably benign Het
Ncoa6 A T 2: 155,415,865 M586K probably damaging Het
Ndel1 C T 11: 68,822,571 probably benign Het
Ndst4 T C 3: 125,561,419 probably benign Het
Nes T G 3: 87,975,952 V506G probably damaging Het
Nrg1 T C 8: 31,849,344 K200E probably damaging Het
Nt5c1b A G 12: 10,375,515 K295E probably damaging Het
Olfr1085 A T 2: 86,658,050 M136K probably damaging Het
Olfr1278 G A 2: 111,292,384 V39M possibly damaging Het
Olfr1487 T A 19: 13,619,153 probably null Het
Olfr750 T A 14: 51,070,722 I224L probably damaging Het
Olfr878 C T 9: 37,919,437 T260I probably damaging Het
Olfr919 G T 9: 38,697,711 Y218* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde1a A G 2: 79,887,839 probably null Het
Pds5a A G 5: 65,643,985 probably benign Het
Plbd1 A T 6: 136,613,721 probably benign Het
Plod2 T A 9: 92,591,397 V292E probably benign Het
Polg A G 7: 79,454,071 V879A possibly damaging Het
Ppargc1a C T 5: 51,473,911 A459T probably damaging Het
Psip1 T C 4: 83,476,322 E83G probably damaging Het
Rhbdf1 T C 11: 32,209,847 D843G probably benign Het
Rnpepl1 G T 1: 92,917,712 C451F probably damaging Het
Rrp1 T C 10: 78,405,415 D206G probably damaging Het
Setbp1 A T 18: 78,755,488 D1492E probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a6 C T 11: 109,473,196 probably benign Homo
Slc7a6os A G 8: 106,210,805 S37P probably damaging Het
Tenm4 T A 7: 96,845,895 S1140T probably damaging Het
Thoc6 C A 17: 23,670,341 R115L probably benign Het
Tmem63c C T 12: 87,075,172 H385Y probably benign Het
Trpm8 G T 1: 88,351,415 E649* probably null Het
Usf1 A G 1: 171,417,779 E253G possibly damaging Het
Vps13d T C 4: 145,074,975 T443A probably benign Het
Wdr86 T C 5: 24,722,662 Y93C probably damaging Het
Zfp597 A T 16: 3,865,821 I357N probably damaging Het
Zfp709 A G 8: 71,890,220 I497V possibly damaging Het
Zxdc T C 6: 90,370,325 S223P probably damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 splice site probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3803:Alpk1 UTSW 3 127679837 missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127677716 missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127685320 splice site probably benign
R5169:Alpk1 UTSW 3 127671101 missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127684375 nonsense probably null
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
R8029:Alpk1 UTSW 3 127729285 missense possibly damaging 0.95
R8383:Alpk1 UTSW 3 127724436 missense probably benign 0.41
Z1176:Alpk1 UTSW 3 127673438 missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127685307 missense
Predicted Primers PCR Primer
(F):5'- AGCAACAGTATCAGCTTTTACAGG -3'
(R):5'- TGGAAAAGGCCTGATCTATCTC -3'

Sequencing Primer
(F):5'- ATCTTTTCCTGGCAAGCAAGG -3'
(R):5'- AAGGCCTGATCTATCTCACGGATC -3'
Posted On2017-02-28