Incidental Mutation 'R5940:Pds5a'
ID462483
Institutional Source Beutler Lab
Gene Symbol Pds5a
Ensembl Gene ENSMUSG00000029202
Gene NamePDS5 cohesin associated factor A
Synonyms9030416H16Rik, E230024D05Rik
MMRRC Submission 044132-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5940 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65605721-65698273 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 65643985 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031104] [ENSMUST00000201948]
Predicted Effect probably benign
Transcript: ENSMUST00000031104
SMART Domains Protein: ENSMUSP00000031104
Gene: ENSMUSG00000029202

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201109
Predicted Effect probably benign
Transcript: ENSMUST00000201948
SMART Domains Protein: ENSMUSP00000144171
Gene: ENSMUSG00000029202

DomainStartEndE-ValueType
SCOP:d1gw5a_ 253 782 6e-30 SMART
low complexity region 934 946 N/A INTRINSIC
low complexity region 1174 1190 N/A INTRINSIC
low complexity region 1258 1276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the cohesin complex and associates with chromatin through most of the cell cycle. The encoded protein may play a role in regulating sister chromatid cohesion during mitosis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with respiratory distress, abnormal heart development, abnormal skeletal development, kidney agenesis, and delayed enteric nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,893,288 probably benign Het
1110008L16Rik T A 12: 55,304,874 W323R probably damaging Het
1500015O10Rik C T 1: 43,737,241 R41* probably null Het
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
5430419D17Rik A T 7: 131,238,263 D638V probably damaging Het
Aasdh G T 5: 76,882,898 S618R probably benign Het
Alpk1 T G 3: 127,670,946 T1228P probably benign Het
Ank3 T C 10: 69,920,486 V850A probably benign Het
Apeh A T 9: 108,091,899 probably null Het
Ash1l C T 3: 88,984,036 T1074I probably damaging Het
C3 G A 17: 57,210,244 S1297F possibly damaging Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cd93 A T 2: 148,442,232 I398N probably benign Het
Chrd G T 16: 20,734,586 R226L probably null Het
Clvs1 A T 4: 9,449,443 N344I possibly damaging Het
Cyp4v3 A T 8: 45,321,784 I111N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Cysltr2 T A 14: 73,029,949 Y107F probably damaging Het
Defb47 A T 14: 63,000,910 E28D probably benign Het
Dnajc30 T A 5: 135,064,559 Y103* probably null Het
Drap1 T C 19: 5,423,000 T160A probably benign Het
Dsp A G 13: 38,196,026 E2249G possibly damaging Het
E2f8 T A 7: 48,871,077 I499F probably benign Het
Ebf1 T A 11: 44,621,221 Y116N probably damaging Het
Ect2 C A 3: 27,115,465 E746D probably benign Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Fat4 T C 3: 38,889,649 V897A probably benign Het
Gja3 T A 14: 57,035,860 S352C probably damaging Het
Gm884 T C 11: 103,613,886 S243G probably benign Het
Gpr153 C A 4: 152,283,375 P561Q probably benign Het
Hlcs T C 16: 94,134,712 M574V probably damaging Het
Hmcn1 A G 1: 150,657,222 V3070A probably benign Het
Hsd3b2 G T 3: 98,711,971 N219K probably benign Het
Htra3 T C 5: 35,652,980 I453V possibly damaging Het
Klrc1 A T 6: 129,674,935 M220K possibly damaging Het
Kntc1 T G 5: 123,786,195 I1048S probably benign Het
Macf1 T A 4: 123,432,881 D2822V probably damaging Het
Mcu T A 10: 59,456,732 I42F possibly damaging Het
Mkln1 T A 6: 31,489,372 D521E probably damaging Het
Ms4a13 T C 19: 11,192,966 N5D possibly damaging Het
Msh3 T G 13: 92,249,843 N838T probably damaging Het
Msl2 T A 9: 101,101,091 C221* probably null Het
Ncapd2 A G 6: 125,168,869 S1310P probably benign Het
Ncoa6 A T 2: 155,415,865 M586K probably damaging Het
Ndel1 C T 11: 68,822,571 probably benign Het
Ndst4 T C 3: 125,561,419 probably benign Het
Nes T G 3: 87,975,952 V506G probably damaging Het
Nrg1 T C 8: 31,849,344 K200E probably damaging Het
Nt5c1b A G 12: 10,375,515 K295E probably damaging Het
Olfr1085 A T 2: 86,658,050 M136K probably damaging Het
Olfr1278 G A 2: 111,292,384 V39M possibly damaging Het
Olfr1487 T A 19: 13,619,153 probably null Het
Olfr750 T A 14: 51,070,722 I224L probably damaging Het
Olfr878 C T 9: 37,919,437 T260I probably damaging Het
Olfr919 G T 9: 38,697,711 Y218* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde1a A G 2: 79,887,839 probably null Het
Plbd1 A T 6: 136,613,721 probably benign Het
Plod2 T A 9: 92,591,397 V292E probably benign Het
Polg A G 7: 79,454,071 V879A possibly damaging Het
Ppargc1a C T 5: 51,473,911 A459T probably damaging Het
Psip1 T C 4: 83,476,322 E83G probably damaging Het
Rhbdf1 T C 11: 32,209,847 D843G probably benign Het
Rnpepl1 G T 1: 92,917,712 C451F probably damaging Het
Rrp1 T C 10: 78,405,415 D206G probably damaging Het
Setbp1 A T 18: 78,755,488 D1492E probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a6 C T 11: 109,473,196 probably benign Homo
Slc7a6os A G 8: 106,210,805 S37P probably damaging Het
Tenm4 T A 7: 96,845,895 S1140T probably damaging Het
Thoc6 C A 17: 23,670,341 R115L probably benign Het
Tmem63c C T 12: 87,075,172 H385Y probably benign Het
Trpm8 G T 1: 88,351,415 E649* probably null Het
Usf1 A G 1: 171,417,779 E253G possibly damaging Het
Vps13d T C 4: 145,074,975 T443A probably benign Het
Wdr86 T C 5: 24,722,662 Y93C probably damaging Het
Zfp597 A T 16: 3,865,821 I357N probably damaging Het
Zfp709 A G 8: 71,890,220 I497V possibly damaging Het
Zxdc T C 6: 90,370,325 S223P probably damaging Het
Other mutations in Pds5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Pds5a APN 5 65656344 missense probably damaging 1.00
IGL00979:Pds5a APN 5 65631723 missense probably benign 0.22
IGL01314:Pds5a APN 5 65615294 missense probably benign
IGL02449:Pds5a APN 5 65619010 missense probably damaging 1.00
IGL02539:Pds5a APN 5 65666119 missense probably damaging 1.00
IGL03395:Pds5a APN 5 65652449 missense possibly damaging 0.61
R0569:Pds5a UTSW 5 65656401 missense probably damaging 1.00
R0704:Pds5a UTSW 5 65620585 missense probably damaging 1.00
R1170:Pds5a UTSW 5 65635302 splice site probably benign
R1181:Pds5a UTSW 5 65627202 splice site probably null
R1193:Pds5a UTSW 5 65637802 missense probably damaging 1.00
R1537:Pds5a UTSW 5 65647121 missense probably benign 0.09
R1853:Pds5a UTSW 5 65624029 missense possibly damaging 0.56
R2016:Pds5a UTSW 5 65648007 critical splice acceptor site probably null
R2154:Pds5a UTSW 5 65650498 missense probably damaging 1.00
R2209:Pds5a UTSW 5 65628014 nonsense probably null
R2234:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2235:Pds5a UTSW 5 65654098 missense probably damaging 1.00
R2332:Pds5a UTSW 5 65627079 splice site probably null
R3114:Pds5a UTSW 5 65618985 missense probably damaging 1.00
R3417:Pds5a UTSW 5 65637892 missense probably damaging 0.99
R3820:Pds5a UTSW 5 65654076 missense possibly damaging 0.94
R4152:Pds5a UTSW 5 65666171 nonsense probably null
R4159:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4160:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4161:Pds5a UTSW 5 65664496 missense possibly damaging 0.75
R4230:Pds5a UTSW 5 65629986 missense possibly damaging 0.85
R4491:Pds5a UTSW 5 65635437 missense probably benign
R4647:Pds5a UTSW 5 65656318 missense probably damaging 1.00
R4816:Pds5a UTSW 5 65651289 missense probably damaging 1.00
R4867:Pds5a UTSW 5 65644120 missense probably damaging 1.00
R5001:Pds5a UTSW 5 65696785 missense probably damaging 0.99
R5013:Pds5a UTSW 5 65635337 missense probably benign 0.05
R5054:Pds5a UTSW 5 65637814 missense probably damaging 1.00
R5068:Pds5a UTSW 5 65615272 missense probably damaging 0.99
R5178:Pds5a UTSW 5 65663875 missense probably damaging 1.00
R5269:Pds5a UTSW 5 65663928 missense probably damaging 1.00
R5396:Pds5a UTSW 5 65638577 missense probably benign 0.09
R5704:Pds5a UTSW 5 65627079 splice site probably null
R6306:Pds5a UTSW 5 65656296 missense probably damaging 1.00
R6322:Pds5a UTSW 5 65696834 missense probably benign 0.00
R6467:Pds5a UTSW 5 65652439 missense probably damaging 1.00
R6476:Pds5a UTSW 5 65634287 missense possibly damaging 0.94
R6513:Pds5a UTSW 5 65615601 missense probably benign 0.18
R7304:Pds5a UTSW 5 65619734 missense probably damaging 1.00
R7312:Pds5a UTSW 5 65666227 missense possibly damaging 0.81
R7438:Pds5a UTSW 5 65652535 critical splice acceptor site probably null
R7637:Pds5a UTSW 5 65638604 missense probably benign 0.12
R7654:Pds5a UTSW 5 65618981 missense probably damaging 1.00
R7707:Pds5a UTSW 5 65610133 missense unknown
R7715:Pds5a UTSW 5 65638561 missense possibly damaging 0.96
R7748:Pds5a UTSW 5 65619666 missense possibly damaging 0.93
R7910:Pds5a UTSW 5 65638582 missense possibly damaging 0.85
R7991:Pds5a UTSW 5 65638582 missense possibly damaging 0.85
Z1088:Pds5a UTSW 5 65618986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATTAGTGAGTGCTATGTGCG -3'
(R):5'- AGTGCTTGCTATAATCAGTGCC -3'

Sequencing Primer
(F):5'- GCTATGTGCGGATTTTTCAAATTAGC -3'
(R):5'- GCTTGCTATAATCAGTGCCTAAAGC -3'
Posted On2017-02-28