Incidental Mutation 'R5940:Kntc1'
ID462485
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 044132-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5940 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 123786195 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1048 (I1048S)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect probably benign
Transcript: ENSMUST00000031366
AA Change: I1048S

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: I1048S

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198716
Predicted Effect probably benign
Transcript: ENSMUST00000198841
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,893,288 probably benign Het
1110008L16Rik T A 12: 55,304,874 W323R probably damaging Het
1500015O10Rik C T 1: 43,737,241 R41* probably null Het
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
5430419D17Rik A T 7: 131,238,263 D638V probably damaging Het
Aasdh G T 5: 76,882,898 S618R probably benign Het
Alpk1 T G 3: 127,670,946 T1228P probably benign Het
Ank3 T C 10: 69,920,486 V850A probably benign Het
Apeh A T 9: 108,091,899 probably null Het
Ash1l C T 3: 88,984,036 T1074I probably damaging Het
C3 G A 17: 57,210,244 S1297F possibly damaging Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cd93 A T 2: 148,442,232 I398N probably benign Het
Chrd G T 16: 20,734,586 R226L probably null Het
Clvs1 A T 4: 9,449,443 N344I possibly damaging Het
Cyp4v3 A T 8: 45,321,784 I111N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Cysltr2 T A 14: 73,029,949 Y107F probably damaging Het
Defb47 A T 14: 63,000,910 E28D probably benign Het
Dnajc30 T A 5: 135,064,559 Y103* probably null Het
Drap1 T C 19: 5,423,000 T160A probably benign Het
Dsp A G 13: 38,196,026 E2249G possibly damaging Het
E2f8 T A 7: 48,871,077 I499F probably benign Het
Ebf1 T A 11: 44,621,221 Y116N probably damaging Het
Ect2 C A 3: 27,115,465 E746D probably benign Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Fat4 T C 3: 38,889,649 V897A probably benign Het
Gja3 T A 14: 57,035,860 S352C probably damaging Het
Gm884 T C 11: 103,613,886 S243G probably benign Het
Gpr153 C A 4: 152,283,375 P561Q probably benign Het
Hlcs T C 16: 94,134,712 M574V probably damaging Het
Hmcn1 A G 1: 150,657,222 V3070A probably benign Het
Hsd3b2 G T 3: 98,711,971 N219K probably benign Het
Htra3 T C 5: 35,652,980 I453V possibly damaging Het
Klrc1 A T 6: 129,674,935 M220K possibly damaging Het
Macf1 T A 4: 123,432,881 D2822V probably damaging Het
Mcu T A 10: 59,456,732 I42F possibly damaging Het
Mkln1 T A 6: 31,489,372 D521E probably damaging Het
Ms4a13 T C 19: 11,192,966 N5D possibly damaging Het
Msh3 T G 13: 92,249,843 N838T probably damaging Het
Msl2 T A 9: 101,101,091 C221* probably null Het
Ncapd2 A G 6: 125,168,869 S1310P probably benign Het
Ncoa6 A T 2: 155,415,865 M586K probably damaging Het
Ndel1 C T 11: 68,822,571 probably benign Het
Ndst4 T C 3: 125,561,419 probably benign Het
Nes T G 3: 87,975,952 V506G probably damaging Het
Nrg1 T C 8: 31,849,344 K200E probably damaging Het
Nt5c1b A G 12: 10,375,515 K295E probably damaging Het
Olfr1085 A T 2: 86,658,050 M136K probably damaging Het
Olfr1278 G A 2: 111,292,384 V39M possibly damaging Het
Olfr1487 T A 19: 13,619,153 probably null Het
Olfr750 T A 14: 51,070,722 I224L probably damaging Het
Olfr878 C T 9: 37,919,437 T260I probably damaging Het
Olfr919 G T 9: 38,697,711 Y218* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde1a A G 2: 79,887,839 probably null Het
Pds5a A G 5: 65,643,985 probably benign Het
Plbd1 A T 6: 136,613,721 probably benign Het
Plod2 T A 9: 92,591,397 V292E probably benign Het
Polg A G 7: 79,454,071 V879A possibly damaging Het
Ppargc1a C T 5: 51,473,911 A459T probably damaging Het
Psip1 T C 4: 83,476,322 E83G probably damaging Het
Rhbdf1 T C 11: 32,209,847 D843G probably benign Het
Rnpepl1 G T 1: 92,917,712 C451F probably damaging Het
Rrp1 T C 10: 78,405,415 D206G probably damaging Het
Setbp1 A T 18: 78,755,488 D1492E probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a6 C T 11: 109,473,196 probably benign Homo
Slc7a6os A G 8: 106,210,805 S37P probably damaging Het
Tenm4 T A 7: 96,845,895 S1140T probably damaging Het
Thoc6 C A 17: 23,670,341 R115L probably benign Het
Tmem63c C T 12: 87,075,172 H385Y probably benign Het
Trpm8 G T 1: 88,351,415 E649* probably null Het
Usf1 A G 1: 171,417,779 E253G possibly damaging Het
Vps13d T C 4: 145,074,975 T443A probably benign Het
Wdr86 T C 5: 24,722,662 Y93C probably damaging Het
Zfp597 A T 16: 3,865,821 I357N probably damaging Het
Zfp709 A G 8: 71,890,220 I497V possibly damaging Het
Zxdc T C 6: 90,370,325 S223P probably damaging Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 unclassified probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 unclassified probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5503:Kntc1 UTSW 5 123819876 missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
R7485:Kntc1 UTSW 5 123786956 missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123790938 missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123816755 missense probably benign 0.05
R7687:Kntc1 UTSW 5 123759089 missense probably benign 0.01
R7798:Kntc1 UTSW 5 123786294 missense probably benign
R7798:Kntc1 UTSW 5 123819117 missense possibly damaging 0.94
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGCTGCAGGAGAACTTTGAG -3'
(R):5'- GGCTCTCAAACTTGCATTGTG -3'

Sequencing Primer
(F):5'- CAGGAGAACTTTGAGGTCTTCC -3'
(R):5'- GCCCTGTGCTTATTGGTAAAGAAATG -3'
Posted On2017-02-28