Mutagenetix > Incidental Mutation

Incidental Mutation 'R5940:Dsp'

462518

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

DP, 2300002E22Rik, 5730453H04Rik, rul

MMRRC Submission

044132-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38335270-38382553 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 38380002 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2249 (E2249G)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124830
AA Change: E2249G

PolyPhen 2 Score 0.698 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: E2249G

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127906
AA Change: E1650G

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: E1650G

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.0715

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.0%

Validation Efficiency

96% (88/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	C	14: 32,384,645 (GRCm39)	Y440C	possibly damaging	Het
Aasdh	G	T	5: 77,030,745 (GRCm39)	S618R	probably benign	Het
Alpk1	T	G	3: 127,464,595 (GRCm39)	T1228P	probably benign	Het
Ank3	T	C	10: 69,756,316 (GRCm39)	V850A	probably benign	Het
Apeh	A	T	9: 107,969,098 (GRCm39)		probably null	Het
Ash1l	C	T	3: 88,891,343 (GRCm39)	T1074I	probably damaging	Het
C3	G	A	17: 57,517,244 (GRCm39)	S1297F	possibly damaging	Het
Cchcr1	G	A	17: 35,835,890 (GRCm39)	R284Q	probably damaging	Het
Cd93	A	T	2: 148,284,152 (GRCm39)	I398N	probably benign	Het
Cdcp3	A	T	7: 130,839,992 (GRCm39)	D638V	probably damaging	Het
Chrd	G	T	16: 20,553,336 (GRCm39)	R226L	probably null	Het
Clvs1	A	T	4: 9,449,443 (GRCm39)	N344I	possibly damaging	Het
Cyp4v3	A	T	8: 45,774,821 (GRCm39)	I111N	probably damaging	Het
Cysltr2	T	A	14: 73,267,389 (GRCm39)	Y107F	probably damaging	Het
Cysltr2	T	C	14: 73,266,931 (GRCm39)	K260E	probably benign	Het
Czib	A	G	4: 107,750,485 (GRCm39)		probably benign	Het
Defb47	A	T	14: 63,238,359 (GRCm39)	E28D	probably benign	Het
Dnajc30	T	A	5: 135,093,413 (GRCm39)	Y103*	probably null	Het
Drap1	T	C	19: 5,473,028 (GRCm39)	T160A	probably benign	Het
E2f8	T	A	7: 48,520,825 (GRCm39)	I499F	probably benign	Het
Ebf1	T	A	11: 44,512,048 (GRCm39)	Y116N	probably damaging	Het
Ecrg4	C	T	1: 43,776,401 (GRCm39)	R41*	probably null	Het
Ect2	C	A	3: 27,169,614 (GRCm39)	E746D	probably benign	Het
Enpep	T	A	3: 129,106,227 (GRCm39)	Y333F	probably damaging	Het
Fat4	T	C	3: 38,943,798 (GRCm39)	V897A	probably benign	Het
Gja3	T	A	14: 57,273,317 (GRCm39)	S352C	probably damaging	Het
Gpr153	C	A	4: 152,367,832 (GRCm39)	P561Q	probably benign	Het
Hlcs	T	C	16: 93,935,571 (GRCm39)	M574V	probably damaging	Het
Hmcn1	A	G	1: 150,532,973 (GRCm39)	V3070A	probably benign	Het
Hsd3b2	G	T	3: 98,619,287 (GRCm39)	N219K	probably benign	Het
Htra3	T	C	5: 35,810,324 (GRCm39)	I453V	possibly damaging	Het
Klrc1	A	T	6: 129,651,898 (GRCm39)	M220K	possibly damaging	Het
Kntc1	T	G	5: 123,924,258 (GRCm39)	I1048S	probably benign	Het
Lrrc37	T	C	11: 103,504,712 (GRCm39)	S243G	probably benign	Het
Macf1	T	A	4: 123,326,674 (GRCm39)	D2822V	probably damaging	Het
Mcu	T	A	10: 59,292,554 (GRCm39)	I42F	possibly damaging	Het
Mkln1	T	A	6: 31,466,307 (GRCm39)	D521E	probably damaging	Het
Ms4a13	T	C	19: 11,170,330 (GRCm39)	N5D	possibly damaging	Het
Msh3	T	G	13: 92,386,351 (GRCm39)	N838T	probably damaging	Het
Msl2	T	A	9: 100,978,290 (GRCm39)	C221*	probably null	Het
Ncapd2	A	G	6: 125,145,832 (GRCm39)	S1310P	probably benign	Het
Ncoa6	A	T	2: 155,257,785 (GRCm39)	M586K	probably damaging	Het
Ndel1	C	T	11: 68,713,397 (GRCm39)		probably benign	Het
Ndst4	T	C	3: 125,355,068 (GRCm39)		probably benign	Het
Nes	T	G	3: 87,883,259 (GRCm39)	V506G	probably damaging	Het
Nrg1	T	C	8: 32,339,372 (GRCm39)	K200E	probably damaging	Het
Nt5c1b	A	G	12: 10,425,515 (GRCm39)	K295E	probably damaging	Het
Or4f54	G	A	2: 111,122,729 (GRCm39)	V39M	possibly damaging	Het
Or5b123	T	A	19: 13,596,517 (GRCm39)		probably null	Het
Or6s1	T	A	14: 51,308,179 (GRCm39)	I224L	probably damaging	Het
Or8b4	C	T	9: 37,830,733 (GRCm39)	T260I	probably damaging	Het
Or8g51	G	T	9: 38,609,007 (GRCm39)	Y218*	probably null	Het
Or8k38	A	T	2: 86,488,394 (GRCm39)	M136K	probably damaging	Het
Otx1	C	A	11: 21,947,037 (GRCm39)	A91S	probably damaging	Het
Pde1a	A	G	2: 79,718,183 (GRCm39)		probably null	Het
Pds5a	A	G	5: 65,801,328 (GRCm39)		probably benign	Het
Plbd1	A	T	6: 136,590,719 (GRCm39)		probably benign	Het
Plod2	T	A	9: 92,473,450 (GRCm39)	V292E	probably benign	Het
Polg	A	G	7: 79,103,819 (GRCm39)	V879A	possibly damaging	Het
Ppargc1a	C	T	5: 51,631,253 (GRCm39)	A459T	probably damaging	Het
Prorp	T	A	12: 55,351,659 (GRCm39)	W323R	probably damaging	Het
Psip1	T	C	4: 83,394,559 (GRCm39)	E83G	probably damaging	Het
Rhbdf1	T	C	11: 32,159,847 (GRCm39)	D843G	probably benign	Het
Rnpepl1	G	T	1: 92,845,434 (GRCm39)	C451F	probably damaging	Het
Rrp1	T	C	10: 78,241,249 (GRCm39)	D206G	probably damaging	Het
Setbp1	A	T	18: 78,798,703 (GRCm39)	D1492E	probably damaging	Het
Sh3bp5	C	A	14: 31,099,452 (GRCm39)	R265L	probably benign	Het
Slc16a6	C	T	11: 109,364,022 (GRCm39)		probably benign	Homo
Slc7a6os	A	G	8: 106,937,437 (GRCm39)	S37P	probably damaging	Het
Tenm4	T	A	7: 96,495,102 (GRCm39)	S1140T	probably damaging	Het
Thoc6	C	A	17: 23,889,315 (GRCm39)	R115L	probably benign	Het
Tmem63c	C	T	12: 87,121,946 (GRCm39)	H385Y	probably benign	Het
Trpm8	G	T	1: 88,279,137 (GRCm39)	E649*	probably null	Het
Usf1	A	G	1: 171,245,347 (GRCm39)	E253G	possibly damaging	Het
Vps13d	T	C	4: 144,801,545 (GRCm39)	T443A	probably benign	Het
Wdr86	T	C	5: 24,927,660 (GRCm39)	Y93C	probably damaging	Het
Zfp597	A	T	16: 3,683,685 (GRCm39)	I357N	probably damaging	Het
Zfp709	A	G	8: 72,644,064 (GRCm39)	I497V	possibly damaging	Het
Zxdc	T	C	6: 90,347,307 (GRCm39)	S223P	probably damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38,381,822 (GRCm39)	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38,376,663 (GRCm39)	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38,377,593 (GRCm39)	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38,351,547 (GRCm39)	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38,360,471 (GRCm39)	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38,363,060 (GRCm39)	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38,365,162 (GRCm39)	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38,380,499 (GRCm39)	nonsense	probably null
IGL02833:Dsp	APN	13	38,376,897 (GRCm39)	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38,372,421 (GRCm39)	splice site	probably benign
IGL03353:Dsp	APN	13	38,370,671 (GRCm39)	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38,381,340 (GRCm39)	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38,381,340 (GRCm39)	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38,379,993 (GRCm39)	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38,381,681 (GRCm39)	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38,371,869 (GRCm39)	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38,371,869 (GRCm39)	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38,356,770 (GRCm39)	missense	probably benign
R0326:Dsp	UTSW	13	38,376,846 (GRCm39)	nonsense	probably null
R0332:Dsp	UTSW	13	38,366,204 (GRCm39)	nonsense	probably null
R0471:Dsp	UTSW	13	38,377,326 (GRCm39)	nonsense	probably null
R0567:Dsp	UTSW	13	38,376,414 (GRCm39)	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38,371,717 (GRCm39)	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38,380,740 (GRCm39)	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38,367,194 (GRCm39)	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38,367,082 (GRCm39)	splice site	probably benign
R1183:Dsp	UTSW	13	38,375,716 (GRCm39)	nonsense	probably null
R1188:Dsp	UTSW	13	38,378,939 (GRCm39)	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38,370,671 (GRCm39)	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38,375,907 (GRCm39)	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38,376,688 (GRCm39)	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38,376,688 (GRCm39)	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38,365,114 (GRCm39)	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38,359,123 (GRCm39)	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38,379,714 (GRCm39)	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38,377,350 (GRCm39)	nonsense	probably null
R1736:Dsp	UTSW	13	38,376,966 (GRCm39)	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38,380,593 (GRCm39)	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38,377,171 (GRCm39)	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38,348,831 (GRCm39)	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38,375,434 (GRCm39)	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38,380,427 (GRCm39)	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38,360,383 (GRCm39)	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38,381,022 (GRCm39)	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38,377,453 (GRCm39)	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38,380,380 (GRCm39)	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38,376,224 (GRCm39)	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38,377,318 (GRCm39)	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38,361,175 (GRCm39)	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38,381,594 (GRCm39)	missense	probably benign	0.00
R3725:Dsp	UTSW	13	38,378,665 (GRCm39)	splice site	probably null
R3797:Dsp	UTSW	13	38,361,260 (GRCm39)	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38,381,681 (GRCm39)	missense	probably benign
R4030:Dsp	UTSW	13	38,375,404 (GRCm39)	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38,370,689 (GRCm39)	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38,369,207 (GRCm39)	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38,380,640 (GRCm39)	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38,379,108 (GRCm39)	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38,375,608 (GRCm39)	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38,352,617 (GRCm39)	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38,380,760 (GRCm39)	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38,375,595 (GRCm39)	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38,380,016 (GRCm39)	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38,379,080 (GRCm39)	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38,351,504 (GRCm39)	nonsense	probably null
R4830:Dsp	UTSW	13	38,376,840 (GRCm39)	missense	probably benign
R4850:Dsp	UTSW	13	38,376,445 (GRCm39)	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38,375,686 (GRCm39)	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38,381,846 (GRCm39)	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38,376,886 (GRCm39)	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38,366,210 (GRCm39)	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38,381,678 (GRCm39)	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38,381,099 (GRCm39)	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38,381,678 (GRCm39)	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38,379,821 (GRCm39)	missense	possibly damaging	0.50
R5138:Dsp	UTSW	13	38,367,274 (GRCm39)	missense	probably benign	0.37
R5153:Dsp	UTSW	13	38,366,282 (GRCm39)	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38,376,878 (GRCm39)	nonsense	probably null
R5226:Dsp	UTSW	13	38,370,746 (GRCm39)	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38,379,159 (GRCm39)	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38,378,865 (GRCm39)	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38,368,014 (GRCm39)	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38,379,818 (GRCm39)	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38,376,628 (GRCm39)	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38,351,477 (GRCm39)	splice site	probably null
R5910:Dsp	UTSW	13	38,376,445 (GRCm39)	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38,379,410 (GRCm39)	missense	possibly damaging	0.92
R5948:Dsp	UTSW	13	38,379,377 (GRCm39)	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38,378,934 (GRCm39)	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38,379,678 (GRCm39)	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38,351,585 (GRCm39)	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38,376,023 (GRCm39)	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38,376,382 (GRCm39)	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38,380,982 (GRCm39)	nonsense	probably null
R6527:Dsp	UTSW	13	38,379,849 (GRCm39)	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38,380,838 (GRCm39)	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38,351,598 (GRCm39)	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38,376,186 (GRCm39)	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38,376,193 (GRCm39)	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38,351,631 (GRCm39)	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38,351,622 (GRCm39)	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38,370,683 (GRCm39)	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38,375,716 (GRCm39)	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38,363,049 (GRCm39)	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38,379,569 (GRCm39)	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38,372,511 (GRCm39)	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38,377,524 (GRCm39)	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38,376,859 (GRCm39)	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38,381,501 (GRCm39)	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38,356,819 (GRCm39)	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38,381,172 (GRCm39)	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38,379,425 (GRCm39)	missense	probably benign	0.00
R7439:Dsp	UTSW	13	38,360,478 (GRCm39)	critical splice donor site	probably null
R7441:Dsp	UTSW	13	38,379,425 (GRCm39)	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38,356,839 (GRCm39)	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38,376,765 (GRCm39)	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38,352,742 (GRCm39)	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38,375,691 (GRCm39)	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38,375,458 (GRCm39)	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38,359,183 (GRCm39)	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38,369,151 (GRCm39)	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38,375,446 (GRCm39)	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38,367,994 (GRCm39)	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38,351,615 (GRCm39)	nonsense	probably null
R7971:Dsp	UTSW	13	38,376,499 (GRCm39)	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38,352,600 (GRCm39)	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38,376,786 (GRCm39)	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38,381,319 (GRCm39)	missense	probably benign
R8323:Dsp	UTSW	13	38,356,806 (GRCm39)	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38,375,611 (GRCm39)	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38,376,457 (GRCm39)	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38,380,791 (GRCm39)	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38,369,117 (GRCm39)	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38,352,701 (GRCm39)	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38,381,502 (GRCm39)	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38,365,155 (GRCm39)	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38,365,155 (GRCm39)	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38,335,596 (GRCm39)	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38,376,700 (GRCm39)	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38,380,808 (GRCm39)	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38,352,673 (GRCm39)	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38,377,276 (GRCm39)	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38,377,126 (GRCm39)	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38,377,337 (GRCm39)	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38,376,379 (GRCm39)	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38,377,218 (GRCm39)	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38,371,781 (GRCm39)	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38,367,937 (GRCm39)	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38,379,494 (GRCm39)	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38,381,660 (GRCm39)	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38,377,231 (GRCm39)	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38,370,622 (GRCm39)	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38,366,288 (GRCm39)	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38,381,166 (GRCm39)	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38,376,830 (GRCm39)	frame shift	probably null
Z1177:Dsp	UTSW	13	38,335,665 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGAAGGTCAGCTACATGCAGC -3'
(R):5'- CAGGTAGCCTTAAATTGCTGACG -3'

Sequencing Primer
(F):5'- CTACATGCAGCTGAGAGAAAGGTG -3'
(R):5'- TAGCCTTAAATTGCTGACGGGATCC -3'

Posted On

2017-02-28