Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Adamtsl1'

46252

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

038759-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86418552 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 1558 (L1558S)

Ref Sequence

ENSEMBL: ENSMUSP00000119278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107177

Predicted Effect

probably damaging
Transcript: ENSMUST00000107178
AA Change: L1566S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: L1566S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141889
AA Change: L1558S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: L1558S

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R4971:Adamtsl1	UTSW	4	86336931	missense	probably damaging	1.00
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense
R7908:Adamtsl1	UTSW	4	86356439	missense	probably benign	0.02
R7934:Adamtsl1	UTSW	4	86243725	missense	probably damaging	1.00
R8056:Adamtsl1	UTSW	4	86342032	missense	possibly damaging	0.76
R8109:Adamtsl1	UTSW	4	86248069	missense
R8143:Adamtsl1	UTSW	4	86342255	missense	possibly damaging	0.71
R8205:Adamtsl1	UTSW	4	86199413	makesense	probably null
R8215:Adamtsl1	UTSW	4	86343145	missense	probably benign	0.45
R8250:Adamtsl1	UTSW	4	86342609	missense	probably damaging	1.00
R8261:Adamtsl1	UTSW	4	86276883	missense	probably damaging	0.99
R8417:Adamtsl1	UTSW	4	86156689	missense	possibly damaging	0.81
R8494:Adamtsl1	UTSW	4	86321984	missense	probably damaging	0.99
R8516:Adamtsl1	UTSW	4	86342543	missense	probably damaging	1.00
R8525:Adamtsl1	UTSW	4	86277010	missense	probably damaging	1.00
Z1176:Adamtsl1	UTSW	4	86342177	missense	probably damaging	0.99
Z1176:Adamtsl1	UTSW	4	86342693	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- AGCAAGGATCATTCCCTGCTGC -3'
(R):5'- GCTAATGCCTCAGAATAGCCTCCAC -3'

Sequencing Primer
(F):5'- TCTCCTCAGATGGATGGTGA -3'
(R):5'- Acaaccaaccaaccaaccaac -3'

Posted On

2013-06-11