Incidental Mutation 'R5940:Gja3'
ID462523
Institutional Source Beutler Lab
Gene Symbol Gja3
Ensembl Gene ENSMUSG00000048582
Gene Namegap junction protein, alpha 3
SynonymsCx46, Gja-3, connexin 46, alpha 3 connexin
MMRRC Submission 044132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5940 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57034460-57058100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57035860 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 352 (S352C)
Ref Sequence ENSEMBL: ENSMUSP00000059587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061614] [ENSMUST00000223792]
Predicted Effect probably damaging
Transcript: ENSMUST00000061614
AA Change: S352C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059587
Gene: ENSMUSG00000048582
AA Change: S352C

DomainStartEndE-ValueType
CNX 43 76 4.4e-21 SMART
low complexity region 103 116 N/A INTRINSIC
Connexin_CCC 165 231 3.36e-44 SMART
low complexity region 342 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223792
Meta Mutation Damage Score 0.2038 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a connexin and is a component of lens fiber gap junctions. Defects in this gene are a cause of zonular pulverulent cataract type 3 (CZP3). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutants exhibit lens nuclear cataracts associated with breakdown of gamma crystallin. Severity of the defect is influenced by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,893,288 probably benign Het
1110008L16Rik T A 12: 55,304,874 W323R probably damaging Het
1500015O10Rik C T 1: 43,737,241 R41* probably null Het
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
5430419D17Rik A T 7: 131,238,263 D638V probably damaging Het
Aasdh G T 5: 76,882,898 S618R probably benign Het
Alpk1 T G 3: 127,670,946 T1228P probably benign Het
Ank3 T C 10: 69,920,486 V850A probably benign Het
Apeh A T 9: 108,091,899 probably null Het
Ash1l C T 3: 88,984,036 T1074I probably damaging Het
C3 G A 17: 57,210,244 S1297F possibly damaging Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cd93 A T 2: 148,442,232 I398N probably benign Het
Chrd G T 16: 20,734,586 R226L probably null Het
Clvs1 A T 4: 9,449,443 N344I possibly damaging Het
Cyp4v3 A T 8: 45,321,784 I111N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Cysltr2 T A 14: 73,029,949 Y107F probably damaging Het
Defb47 A T 14: 63,000,910 E28D probably benign Het
Dnajc30 T A 5: 135,064,559 Y103* probably null Het
Drap1 T C 19: 5,423,000 T160A probably benign Het
Dsp A G 13: 38,196,026 E2249G possibly damaging Het
E2f8 T A 7: 48,871,077 I499F probably benign Het
Ebf1 T A 11: 44,621,221 Y116N probably damaging Het
Ect2 C A 3: 27,115,465 E746D probably benign Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Fat4 T C 3: 38,889,649 V897A probably benign Het
Gm884 T C 11: 103,613,886 S243G probably benign Het
Gpr153 C A 4: 152,283,375 P561Q probably benign Het
Hlcs T C 16: 94,134,712 M574V probably damaging Het
Hmcn1 A G 1: 150,657,222 V3070A probably benign Het
Hsd3b2 G T 3: 98,711,971 N219K probably benign Het
Htra3 T C 5: 35,652,980 I453V possibly damaging Het
Klrc1 A T 6: 129,674,935 M220K possibly damaging Het
Kntc1 T G 5: 123,786,195 I1048S probably benign Het
Macf1 T A 4: 123,432,881 D2822V probably damaging Het
Mcu T A 10: 59,456,732 I42F possibly damaging Het
Mkln1 T A 6: 31,489,372 D521E probably damaging Het
Ms4a13 T C 19: 11,192,966 N5D possibly damaging Het
Msh3 T G 13: 92,249,843 N838T probably damaging Het
Msl2 T A 9: 101,101,091 C221* probably null Het
Ncapd2 A G 6: 125,168,869 S1310P probably benign Het
Ncoa6 A T 2: 155,415,865 M586K probably damaging Het
Ndel1 C T 11: 68,822,571 probably benign Het
Ndst4 T C 3: 125,561,419 probably benign Het
Nes T G 3: 87,975,952 V506G probably damaging Het
Nrg1 T C 8: 31,849,344 K200E probably damaging Het
Nt5c1b A G 12: 10,375,515 K295E probably damaging Het
Olfr1085 A T 2: 86,658,050 M136K probably damaging Het
Olfr1278 G A 2: 111,292,384 V39M possibly damaging Het
Olfr1487 T A 19: 13,619,153 probably null Het
Olfr750 T A 14: 51,070,722 I224L probably damaging Het
Olfr878 C T 9: 37,919,437 T260I probably damaging Het
Olfr919 G T 9: 38,697,711 Y218* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde1a A G 2: 79,887,839 probably null Het
Pds5a A G 5: 65,643,985 probably benign Het
Plbd1 A T 6: 136,613,721 probably benign Het
Plod2 T A 9: 92,591,397 V292E probably benign Het
Polg A G 7: 79,454,071 V879A possibly damaging Het
Ppargc1a C T 5: 51,473,911 A459T probably damaging Het
Psip1 T C 4: 83,476,322 E83G probably damaging Het
Rhbdf1 T C 11: 32,209,847 D843G probably benign Het
Rnpepl1 G T 1: 92,917,712 C451F probably damaging Het
Rrp1 T C 10: 78,405,415 D206G probably damaging Het
Setbp1 A T 18: 78,755,488 D1492E probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a6 C T 11: 109,473,196 probably benign Homo
Slc7a6os A G 8: 106,210,805 S37P probably damaging Het
Tenm4 T A 7: 96,845,895 S1140T probably damaging Het
Thoc6 C A 17: 23,670,341 R115L probably benign Het
Tmem63c C T 12: 87,075,172 H385Y probably benign Het
Trpm8 G T 1: 88,351,415 E649* probably null Het
Usf1 A G 1: 171,417,779 E253G possibly damaging Het
Vps13d T C 4: 145,074,975 T443A probably benign Het
Wdr86 T C 5: 24,722,662 Y93C probably damaging Het
Zfp597 A T 16: 3,865,821 I357N probably damaging Het
Zfp709 A G 8: 71,890,220 I497V possibly damaging Het
Zxdc T C 6: 90,370,325 S223P probably damaging Het
Other mutations in Gja3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02023:Gja3 APN 14 57035679 missense probably damaging 1.00
R0470:Gja3 UTSW 14 57036427 missense probably damaging 1.00
R0631:Gja3 UTSW 14 57036762 missense possibly damaging 0.95
R1455:Gja3 UTSW 14 57036385 missense probably damaging 1.00
R1687:Gja3 UTSW 14 57036876 missense probably damaging 0.99
R2229:Gja3 UTSW 14 57036714 missense probably damaging 1.00
R3846:Gja3 UTSW 14 57035704 nonsense probably null
R5337:Gja3 UTSW 14 57035832 missense probably benign 0.22
R5797:Gja3 UTSW 14 57035713 missense probably damaging 0.98
R7226:Gja3 UTSW 14 57035893 missense probably benign 0.01
R8066:Gja3 UTSW 14 57035806 missense not run
Z1088:Gja3 UTSW 14 57035815 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GGAATGACTATGGCTAGATGGC -3'
(R):5'- AAAGGCCATAGGGTTTCCTGG -3'

Sequencing Primer
(F):5'- TAGATGGCCAAGTCACCTGGTC -3'
(R):5'- ATAGGGTTTCCTGGGGCCC -3'
Posted On2017-02-28