Incidental Mutation 'R5940:Chrd'
ID 462528
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Name chordin
Synonyms Chd
MMRRC Submission 044132-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5940 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 20551877-20561134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 20553336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 226 (R226L)
Ref Sequence ENSEMBL: ENSMUSP00000156080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000076422] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000232646] [ENSMUST00000231826] [ENSMUST00000232217]
AlphaFold Q9Z0E2
Predicted Effect probably null
Transcript: ENSMUST00000007171
AA Change: R204L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: R204L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076422
SMART Domains Protein: ENSMUSP00000075756
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 24 188 9.4e-78 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115423
AA Change: R204L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958
AA Change: R204L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
AA Change: R204L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958
AA Change: R204L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
AA Change: R204L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect probably benign
Transcript: ENSMUST00000231698
AA Change: R226L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably null
Transcript: ENSMUST00000232646
AA Change: R226L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably null
Transcript: ENSMUST00000231826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect probably null
Transcript: ENSMUST00000232217
Meta Mutation Damage Score 0.5252 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,384,645 (GRCm39) Y440C possibly damaging Het
Aasdh G T 5: 77,030,745 (GRCm39) S618R probably benign Het
Alpk1 T G 3: 127,464,595 (GRCm39) T1228P probably benign Het
Ank3 T C 10: 69,756,316 (GRCm39) V850A probably benign Het
Apeh A T 9: 107,969,098 (GRCm39) probably null Het
Ash1l C T 3: 88,891,343 (GRCm39) T1074I probably damaging Het
C3 G A 17: 57,517,244 (GRCm39) S1297F possibly damaging Het
Cchcr1 G A 17: 35,835,890 (GRCm39) R284Q probably damaging Het
Cd93 A T 2: 148,284,152 (GRCm39) I398N probably benign Het
Cdcp3 A T 7: 130,839,992 (GRCm39) D638V probably damaging Het
Clvs1 A T 4: 9,449,443 (GRCm39) N344I possibly damaging Het
Cyp4v3 A T 8: 45,774,821 (GRCm39) I111N probably damaging Het
Cysltr2 T A 14: 73,267,389 (GRCm39) Y107F probably damaging Het
Cysltr2 T C 14: 73,266,931 (GRCm39) K260E probably benign Het
Czib A G 4: 107,750,485 (GRCm39) probably benign Het
Defb47 A T 14: 63,238,359 (GRCm39) E28D probably benign Het
Dnajc30 T A 5: 135,093,413 (GRCm39) Y103* probably null Het
Drap1 T C 19: 5,473,028 (GRCm39) T160A probably benign Het
Dsp A G 13: 38,380,002 (GRCm39) E2249G possibly damaging Het
E2f8 T A 7: 48,520,825 (GRCm39) I499F probably benign Het
Ebf1 T A 11: 44,512,048 (GRCm39) Y116N probably damaging Het
Ecrg4 C T 1: 43,776,401 (GRCm39) R41* probably null Het
Ect2 C A 3: 27,169,614 (GRCm39) E746D probably benign Het
Enpep T A 3: 129,106,227 (GRCm39) Y333F probably damaging Het
Fat4 T C 3: 38,943,798 (GRCm39) V897A probably benign Het
Gja3 T A 14: 57,273,317 (GRCm39) S352C probably damaging Het
Gpr153 C A 4: 152,367,832 (GRCm39) P561Q probably benign Het
Hlcs T C 16: 93,935,571 (GRCm39) M574V probably damaging Het
Hmcn1 A G 1: 150,532,973 (GRCm39) V3070A probably benign Het
Hsd3b2 G T 3: 98,619,287 (GRCm39) N219K probably benign Het
Htra3 T C 5: 35,810,324 (GRCm39) I453V possibly damaging Het
Klrc1 A T 6: 129,651,898 (GRCm39) M220K possibly damaging Het
Kntc1 T G 5: 123,924,258 (GRCm39) I1048S probably benign Het
Lrrc37 T C 11: 103,504,712 (GRCm39) S243G probably benign Het
Macf1 T A 4: 123,326,674 (GRCm39) D2822V probably damaging Het
Mcu T A 10: 59,292,554 (GRCm39) I42F possibly damaging Het
Mkln1 T A 6: 31,466,307 (GRCm39) D521E probably damaging Het
Ms4a13 T C 19: 11,170,330 (GRCm39) N5D possibly damaging Het
Msh3 T G 13: 92,386,351 (GRCm39) N838T probably damaging Het
Msl2 T A 9: 100,978,290 (GRCm39) C221* probably null Het
Ncapd2 A G 6: 125,145,832 (GRCm39) S1310P probably benign Het
Ncoa6 A T 2: 155,257,785 (GRCm39) M586K probably damaging Het
Ndel1 C T 11: 68,713,397 (GRCm39) probably benign Het
Ndst4 T C 3: 125,355,068 (GRCm39) probably benign Het
Nes T G 3: 87,883,259 (GRCm39) V506G probably damaging Het
Nrg1 T C 8: 32,339,372 (GRCm39) K200E probably damaging Het
Nt5c1b A G 12: 10,425,515 (GRCm39) K295E probably damaging Het
Or4f54 G A 2: 111,122,729 (GRCm39) V39M possibly damaging Het
Or5b123 T A 19: 13,596,517 (GRCm39) probably null Het
Or6s1 T A 14: 51,308,179 (GRCm39) I224L probably damaging Het
Or8b4 C T 9: 37,830,733 (GRCm39) T260I probably damaging Het
Or8g51 G T 9: 38,609,007 (GRCm39) Y218* probably null Het
Or8k38 A T 2: 86,488,394 (GRCm39) M136K probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Pde1a A G 2: 79,718,183 (GRCm39) probably null Het
Pds5a A G 5: 65,801,328 (GRCm39) probably benign Het
Plbd1 A T 6: 136,590,719 (GRCm39) probably benign Het
Plod2 T A 9: 92,473,450 (GRCm39) V292E probably benign Het
Polg A G 7: 79,103,819 (GRCm39) V879A possibly damaging Het
Ppargc1a C T 5: 51,631,253 (GRCm39) A459T probably damaging Het
Prorp T A 12: 55,351,659 (GRCm39) W323R probably damaging Het
Psip1 T C 4: 83,394,559 (GRCm39) E83G probably damaging Het
Rhbdf1 T C 11: 32,159,847 (GRCm39) D843G probably benign Het
Rnpepl1 G T 1: 92,845,434 (GRCm39) C451F probably damaging Het
Rrp1 T C 10: 78,241,249 (GRCm39) D206G probably damaging Het
Setbp1 A T 18: 78,798,703 (GRCm39) D1492E probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc16a6 C T 11: 109,364,022 (GRCm39) probably benign Homo
Slc7a6os A G 8: 106,937,437 (GRCm39) S37P probably damaging Het
Tenm4 T A 7: 96,495,102 (GRCm39) S1140T probably damaging Het
Thoc6 C A 17: 23,889,315 (GRCm39) R115L probably benign Het
Tmem63c C T 12: 87,121,946 (GRCm39) H385Y probably benign Het
Trpm8 G T 1: 88,279,137 (GRCm39) E649* probably null Het
Usf1 A G 1: 171,245,347 (GRCm39) E253G possibly damaging Het
Vps13d T C 4: 144,801,545 (GRCm39) T443A probably benign Het
Wdr86 T C 5: 24,927,660 (GRCm39) Y93C probably damaging Het
Zfp597 A T 16: 3,683,685 (GRCm39) I357N probably damaging Het
Zfp709 A G 8: 72,644,064 (GRCm39) I497V possibly damaging Het
Zxdc T C 6: 90,347,307 (GRCm39) S223P probably damaging Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20,559,975 (GRCm39) missense possibly damaging 0.89
IGL01486:Chrd APN 16 20,552,890 (GRCm39) splice site probably null
IGL02120:Chrd APN 16 20,553,291 (GRCm39) missense probably damaging 1.00
IGL02370:Chrd APN 16 20,554,541 (GRCm39) missense possibly damaging 0.52
IGL02675:Chrd APN 16 20,558,699 (GRCm39) splice site probably benign
IGL02678:Chrd APN 16 20,552,770 (GRCm39) missense probably damaging 1.00
IGL02874:Chrd APN 16 20,553,946 (GRCm39) missense probably damaging 1.00
ANU74:Chrd UTSW 16 20,560,069 (GRCm39) missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20,557,748 (GRCm39) critical splice donor site probably null
R0016:Chrd UTSW 16 20,553,058 (GRCm39) missense possibly damaging 0.85
R0230:Chrd UTSW 16 20,552,025 (GRCm39) missense probably benign 0.25
R0605:Chrd UTSW 16 20,554,189 (GRCm39) missense probably damaging 1.00
R0831:Chrd UTSW 16 20,560,059 (GRCm39) missense probably damaging 0.99
R1501:Chrd UTSW 16 20,556,283 (GRCm39) missense probably damaging 1.00
R1659:Chrd UTSW 16 20,554,581 (GRCm39) missense probably damaging 0.96
R1766:Chrd UTSW 16 20,556,191 (GRCm39) missense probably damaging 1.00
R1823:Chrd UTSW 16 20,560,097 (GRCm39) splice site probably benign
R3001:Chrd UTSW 16 20,556,195 (GRCm39) nonsense probably null
R3002:Chrd UTSW 16 20,556,195 (GRCm39) nonsense probably null
R3874:Chrd UTSW 16 20,557,660 (GRCm39) missense probably damaging 0.99
R4319:Chrd UTSW 16 20,555,798 (GRCm39) missense probably damaging 0.99
R4587:Chrd UTSW 16 20,557,325 (GRCm39) missense possibly damaging 0.58
R4707:Chrd UTSW 16 20,557,558 (GRCm39) missense possibly damaging 0.58
R4857:Chrd UTSW 16 20,557,508 (GRCm39) missense possibly damaging 0.79
R5204:Chrd UTSW 16 20,554,822 (GRCm39) missense probably benign 0.02
R5364:Chrd UTSW 16 20,551,898 (GRCm39) start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20,557,660 (GRCm39) missense possibly damaging 0.74
R5611:Chrd UTSW 16 20,557,724 (GRCm39) missense probably damaging 1.00
R6004:Chrd UTSW 16 20,553,987 (GRCm39) missense possibly damaging 0.92
R6767:Chrd UTSW 16 20,557,376 (GRCm39) missense probably benign 0.00
R6798:Chrd UTSW 16 20,553,056 (GRCm39) missense probably damaging 1.00
R6801:Chrd UTSW 16 20,554,497 (GRCm39) missense possibly damaging 0.68
R6823:Chrd UTSW 16 20,553,486 (GRCm39) missense probably damaging 1.00
R6999:Chrd UTSW 16 20,554,402 (GRCm39) missense probably benign
R7069:Chrd UTSW 16 20,558,183 (GRCm39) missense probably damaging 1.00
R7136:Chrd UTSW 16 20,553,272 (GRCm39) missense possibly damaging 0.82
R7273:Chrd UTSW 16 20,560,316 (GRCm39) missense probably benign 0.32
R7558:Chrd UTSW 16 20,557,304 (GRCm39) missense probably damaging 1.00
R7813:Chrd UTSW 16 20,554,155 (GRCm39) missense probably benign 0.00
R7965:Chrd UTSW 16 20,557,903 (GRCm39) missense probably benign 0.05
R8361:Chrd UTSW 16 20,557,487 (GRCm39) missense possibly damaging 0.92
R8549:Chrd UTSW 16 20,560,027 (GRCm39) missense probably benign 0.40
R8809:Chrd UTSW 16 20,553,270 (GRCm39) missense probably benign 0.19
R8841:Chrd UTSW 16 20,554,487 (GRCm39) splice site probably benign
R9027:Chrd UTSW 16 20,555,737 (GRCm39) missense probably damaging 1.00
R9166:Chrd UTSW 16 20,554,572 (GRCm39) missense probably benign 0.28
R9255:Chrd UTSW 16 20,558,801 (GRCm39) missense probably damaging 1.00
R9618:Chrd UTSW 16 20,552,378 (GRCm39) missense probably damaging 1.00
X0063:Chrd UTSW 16 20,556,314 (GRCm39) critical splice donor site probably null
Z1088:Chrd UTSW 16 20,560,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTACAGTGATCGAGGGG -3'
(R):5'- TTGCAGGGTGTTCAAACAGG -3'

Sequencing Primer
(F):5'- TGCTGATGGCCACACAGGTAG -3'
(R):5'- GTGTTCAAACAGGATGTTGCC -3'
Posted On 2017-02-28