Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:C8b'

46253

Institutional Source

Beutler Lab

Gene Symbol

C8b

Ensembl Gene

ENSMUSG00000029656

Gene Name

complement component 8, beta polypeptide

Synonyms

4930439B20Rik

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104766317-104804548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104793380 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 462 (I462V)

Ref Sequence

ENSEMBL: ENSMUSP00000031663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]

AlphaFold

Q8BH35

Predicted Effect

probably benign
Transcript: ENSMUST00000031663
AA Change: I462V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: I462V

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSP1	66	116	3.17e-7	SMART
LDLa	120	156	1.78e-10	SMART
MACPF	290	497	3.6e-65	SMART
Blast:EGF	501	534	9e-12	BLAST
TSP1	547	584	1.17e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000065072
AA Change: I396V

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: I396V

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
TSP1	66	116	3.17e-7	SMART
LDLa	120	156	1.78e-10	SMART
MACPF	224	431	3.6e-65	SMART
Blast:EGF	435	468	1e-11	BLAST
TSP1	481	518	1.17e-1	SMART

Meta Mutation Damage Score

0.3535

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in C8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00659:C8b	APN	4	104801334	splice site	probably benign
IGL01145:C8b	APN	4	104780580	missense	probably benign	0.25
IGL01768:C8b	APN	4	104786954	missense	probably benign	0.00
IGL02347:C8b	APN	4	104786954	missense	probably benign	0.00
IGL02488:C8b	APN	4	104804081	missense	probably benign
IGL02957:C8b	APN	4	104766455	missense	probably benign
IGL02979:C8b	APN	4	104774388	missense	probably damaging	0.99
IGL02995:C8b	APN	4	104801328	splice site	probably benign
IGL03294:C8b	APN	4	104780691	missense	probably benign	0.06
R1015:C8b	UTSW	4	104786960	missense	probably benign	0.19
R1191:C8b	UTSW	4	104793323	missense	probably damaging	1.00
R1401:C8b	UTSW	4	104784482	missense	possibly damaging	0.72
R3824:C8b	UTSW	4	104783009	missense	probably benign	0.42
R4611:C8b	UTSW	4	104790644	missense	probably damaging	0.98
R4756:C8b	UTSW	4	104786886	missense	probably benign
R4845:C8b	UTSW	4	104791812	missense	possibly damaging	0.87
R5355:C8b	UTSW	4	104780663	missense	probably benign	0.01
R5436:C8b	UTSW	4	104800349	nonsense	probably null
R5561:C8b	UTSW	4	104784448	missense	possibly damaging	0.89
R5967:C8b	UTSW	4	104793333	missense	possibly damaging	0.79
R6744:C8b	UTSW	4	104774346	missense	probably damaging	1.00
R6899:C8b	UTSW	4	104786874	missense	probably benign	0.02
R6977:C8b	UTSW	4	104786996	missense	possibly damaging	0.82
R7088:C8b	UTSW	4	104793343	missense	probably benign	0.12
R7224:C8b	UTSW	4	104780598	missense	probably damaging	1.00
R7278:C8b	UTSW	4	104780627	missense	probably damaging	1.00
R8058:C8b	UTSW	4	104790614	missense	probably damaging	0.96
R8437:C8b	UTSW	4	104786843	missense	probably damaging	1.00
R8821:C8b	UTSW	4	104790677	missense	probably damaging	1.00
R8831:C8b	UTSW	4	104790677	missense	probably damaging	1.00
R9139:C8b	UTSW	4	104784434	missense	probably damaging	1.00
R9237:C8b	UTSW	4	104793284	missense	probably benign	0.00
R9294:C8b	UTSW	4	104786995	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATAGACCCTTTGGTTCCATGCCGC -3'
(R):5'- TGAACTCAGCAGGTGCTCCAAAC -3'

Sequencing Primer
(F):5'- GGTTCCATGCCGCTCTTTC -3'
(R):5'- CTTAGTAGCTTGGGGACCAAC -3'

Posted On

2013-06-11