Incidental Mutation 'R0568:C8b'
ID 46253
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Name complement component 8, beta polypeptide
Synonyms 4930439B20Rik
MMRRC Submission 038759-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0568 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 104766317-104804548 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104793380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 462 (I462V)
Ref Sequence ENSEMBL: ENSMUSP00000031663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
AlphaFold Q8BH35
Predicted Effect probably benign
Transcript: ENSMUST00000031663
AA Change: I462V

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: I462V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065072
AA Change: I396V

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: I396V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Meta Mutation Damage Score 0.3535 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik C T 10: 77,983,038 T181I possibly damaging Het
1810043G02Rik A T 10: 77,984,547 *250C probably null Het
Acnat1 G A 4: 49,451,003 T36I possibly damaging Het
Adamts20 T C 15: 94,291,713 probably benign Het
Adamtsl1 T C 4: 86,418,552 L1558S probably damaging Het
Ap3b2 A G 7: 81,464,629 probably null Het
Bag2 T C 1: 33,746,978 M88V probably benign Het
Brms1l A G 12: 55,861,388 probably null Het
Cnpy4 A G 5: 138,192,577 E167G probably damaging Het
Copa T C 1: 172,112,137 V624A possibly damaging Het
Gm4553 G T 7: 142,165,620 P24T unknown Het
Gna12 A G 5: 140,760,883 V269A possibly damaging Het
Gtf2ird2 G T 5: 134,211,242 E302* probably null Het
Hmcn2 C A 2: 31,415,236 S3140R probably benign Het
Hspa4 A G 11: 53,262,876 probably benign Het
Hspbp1 A T 7: 4,684,432 L60* probably null Het
Lats1 A T 10: 7,712,528 I970F possibly damaging Het
Lipo3 T C 19: 33,582,042 probably benign Het
Lrrc3 T A 10: 77,901,585 R6W probably damaging Het
Lxn C T 3: 67,461,002 A143T probably damaging Het
Mga T C 2: 119,935,422 I1390T probably damaging Het
Ncapg2 T A 12: 116,423,215 I286N probably damaging Het
Olfr1212 T A 2: 88,959,043 Y192* probably null Het
Papd4 A G 13: 93,154,992 S381P probably benign Het
Pitpnm2 A G 5: 124,140,517 probably benign Het
Plxna2 T C 1: 194,751,386 V581A probably benign Het
Polr3d A T 14: 70,439,519 H378Q possibly damaging Het
Ptpn13 T C 5: 103,489,765 V173A probably damaging Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smc4 T C 3: 69,022,461 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syngr3 C T 17: 24,686,581 A140T probably benign Het
Tprn T C 2: 25,264,321 V545A probably damaging Het
Trim66 T C 7: 109,460,695 H828R probably benign Het
Ugt2b5 G A 5: 87,137,365 probably benign Het
Vps9d1 A G 8: 123,246,748 V432A probably damaging Het
Zswim9 A T 7: 13,261,026 D401E probably damaging Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104801334 splice site probably benign
IGL01145:C8b APN 4 104780580 missense probably benign 0.25
IGL01768:C8b APN 4 104786954 missense probably benign 0.00
IGL02347:C8b APN 4 104786954 missense probably benign 0.00
IGL02488:C8b APN 4 104804081 missense probably benign
IGL02957:C8b APN 4 104766455 missense probably benign
IGL02979:C8b APN 4 104774388 missense probably damaging 0.99
IGL02995:C8b APN 4 104801328 splice site probably benign
IGL03294:C8b APN 4 104780691 missense probably benign 0.06
R1015:C8b UTSW 4 104786960 missense probably benign 0.19
R1191:C8b UTSW 4 104793323 missense probably damaging 1.00
R1401:C8b UTSW 4 104784482 missense possibly damaging 0.72
R3824:C8b UTSW 4 104783009 missense probably benign 0.42
R4611:C8b UTSW 4 104790644 missense probably damaging 0.98
R4756:C8b UTSW 4 104786886 missense probably benign
R4845:C8b UTSW 4 104791812 missense possibly damaging 0.87
R5355:C8b UTSW 4 104780663 missense probably benign 0.01
R5436:C8b UTSW 4 104800349 nonsense probably null
R5561:C8b UTSW 4 104784448 missense possibly damaging 0.89
R5967:C8b UTSW 4 104793333 missense possibly damaging 0.79
R6744:C8b UTSW 4 104774346 missense probably damaging 1.00
R6899:C8b UTSW 4 104786874 missense probably benign 0.02
R6977:C8b UTSW 4 104786996 missense possibly damaging 0.82
R7088:C8b UTSW 4 104793343 missense probably benign 0.12
R7224:C8b UTSW 4 104780598 missense probably damaging 1.00
R7278:C8b UTSW 4 104780627 missense probably damaging 1.00
R8058:C8b UTSW 4 104790614 missense probably damaging 0.96
R8437:C8b UTSW 4 104786843 missense probably damaging 1.00
R8821:C8b UTSW 4 104790677 missense probably damaging 1.00
R8831:C8b UTSW 4 104790677 missense probably damaging 1.00
R9139:C8b UTSW 4 104784434 missense probably damaging 1.00
R9237:C8b UTSW 4 104793284 missense probably benign 0.00
R9294:C8b UTSW 4 104786995 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATAGACCCTTTGGTTCCATGCCGC -3'
(R):5'- TGAACTCAGCAGGTGCTCCAAAC -3'

Sequencing Primer
(F):5'- GGTTCCATGCCGCTCTTTC -3'
(R):5'- CTTAGTAGCTTGGGGACCAAC -3'
Posted On 2013-06-11