Incidental Mutation 'R5940:C3'
ID462532
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
MMRRC Submission 044132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5940 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57210244 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1297 (S1297F)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024988
AA Change: S1297F

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: S1297F

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,893,288 probably benign Het
1110008L16Rik T A 12: 55,304,874 W323R probably damaging Het
1500015O10Rik C T 1: 43,737,241 R41* probably null Het
3425401B19Rik T C 14: 32,662,688 Y440C possibly damaging Het
5430419D17Rik A T 7: 131,238,263 D638V probably damaging Het
Aasdh G T 5: 76,882,898 S618R probably benign Het
Alpk1 T G 3: 127,670,946 T1228P probably benign Het
Ank3 T C 10: 69,920,486 V850A probably benign Het
Apeh A T 9: 108,091,899 probably null Het
Ash1l C T 3: 88,984,036 T1074I probably damaging Het
Cchcr1 G A 17: 35,524,993 R284Q probably damaging Het
Cd93 A T 2: 148,442,232 I398N probably benign Het
Chrd G T 16: 20,734,586 R226L probably null Het
Clvs1 A T 4: 9,449,443 N344I possibly damaging Het
Cyp4v3 A T 8: 45,321,784 I111N probably damaging Het
Cysltr2 T C 14: 73,029,491 K260E probably benign Het
Cysltr2 T A 14: 73,029,949 Y107F probably damaging Het
Defb47 A T 14: 63,000,910 E28D probably benign Het
Dnajc30 T A 5: 135,064,559 Y103* probably null Het
Drap1 T C 19: 5,423,000 T160A probably benign Het
Dsp A G 13: 38,196,026 E2249G possibly damaging Het
E2f8 T A 7: 48,871,077 I499F probably benign Het
Ebf1 T A 11: 44,621,221 Y116N probably damaging Het
Ect2 C A 3: 27,115,465 E746D probably benign Het
Enpep T A 3: 129,312,578 Y333F probably damaging Het
Fat4 T C 3: 38,889,649 V897A probably benign Het
Gja3 T A 14: 57,035,860 S352C probably damaging Het
Gm884 T C 11: 103,613,886 S243G probably benign Het
Gpr153 C A 4: 152,283,375 P561Q probably benign Het
Hlcs T C 16: 94,134,712 M574V probably damaging Het
Hmcn1 A G 1: 150,657,222 V3070A probably benign Het
Hsd3b2 G T 3: 98,711,971 N219K probably benign Het
Htra3 T C 5: 35,652,980 I453V possibly damaging Het
Klrc1 A T 6: 129,674,935 M220K possibly damaging Het
Kntc1 T G 5: 123,786,195 I1048S probably benign Het
Macf1 T A 4: 123,432,881 D2822V probably damaging Het
Mcu T A 10: 59,456,732 I42F possibly damaging Het
Mkln1 T A 6: 31,489,372 D521E probably damaging Het
Ms4a13 T C 19: 11,192,966 N5D possibly damaging Het
Msh3 T G 13: 92,249,843 N838T probably damaging Het
Msl2 T A 9: 101,101,091 C221* probably null Het
Ncapd2 A G 6: 125,168,869 S1310P probably benign Het
Ncoa6 A T 2: 155,415,865 M586K probably damaging Het
Ndel1 C T 11: 68,822,571 probably benign Het
Ndst4 T C 3: 125,561,419 probably benign Het
Nes T G 3: 87,975,952 V506G probably damaging Het
Nrg1 T C 8: 31,849,344 K200E probably damaging Het
Nt5c1b A G 12: 10,375,515 K295E probably damaging Het
Olfr1085 A T 2: 86,658,050 M136K probably damaging Het
Olfr1278 G A 2: 111,292,384 V39M possibly damaging Het
Olfr1487 T A 19: 13,619,153 probably null Het
Olfr750 T A 14: 51,070,722 I224L probably damaging Het
Olfr878 C T 9: 37,919,437 T260I probably damaging Het
Olfr919 G T 9: 38,697,711 Y218* probably null Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pde1a A G 2: 79,887,839 probably null Het
Pds5a A G 5: 65,643,985 probably benign Het
Plbd1 A T 6: 136,613,721 probably benign Het
Plod2 T A 9: 92,591,397 V292E probably benign Het
Polg A G 7: 79,454,071 V879A possibly damaging Het
Ppargc1a C T 5: 51,473,911 A459T probably damaging Het
Psip1 T C 4: 83,476,322 E83G probably damaging Het
Rhbdf1 T C 11: 32,209,847 D843G probably benign Het
Rnpepl1 G T 1: 92,917,712 C451F probably damaging Het
Rrp1 T C 10: 78,405,415 D206G probably damaging Het
Setbp1 A T 18: 78,755,488 D1492E probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a6 C T 11: 109,473,196 probably benign Homo
Slc7a6os A G 8: 106,210,805 S37P probably damaging Het
Tenm4 T A 7: 96,845,895 S1140T probably damaging Het
Thoc6 C A 17: 23,670,341 R115L probably benign Het
Tmem63c C T 12: 87,075,172 H385Y probably benign Het
Trpm8 G T 1: 88,351,415 E649* probably null Het
Usf1 A G 1: 171,417,779 E253G possibly damaging Het
Vps13d T C 4: 145,074,975 T443A probably benign Het
Wdr86 T C 5: 24,722,662 Y93C probably damaging Het
Zfp597 A T 16: 3,865,821 I357N probably damaging Het
Zfp709 A G 8: 71,890,220 I497V possibly damaging Het
Zxdc T C 6: 90,370,325 S223P probably damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 intron probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 intron probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 intron probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
R7347:C3 UTSW 17 57223215 missense probably benign 0.09
R7366:C3 UTSW 17 57221162 missense probably benign 0.00
R7423:C3 UTSW 17 57214767 missense probably damaging 1.00
R7425:C3 UTSW 17 57204039 missense possibly damaging 0.81
R7481:C3 UTSW 17 57220136 missense probably damaging 1.00
R7540:C3 UTSW 17 57206220 missense probably benign 0.01
R7746:C3 UTSW 17 57218859 missense probably damaging 1.00
R7771:C3 UTSW 17 57215797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTCCTCTGACTCTGAG -3'
(R):5'- CTCCAGAATGGTCTCTGTGTGC -3'

Sequencing Primer
(F):5'- TCTGAGGGCCCTGACAGTTATC -3'
(R):5'- GCTGCTGCCGCCATAATTCTG -3'
Posted On2017-02-28