Incidental Mutation 'R5919:S100a9'
ID462550
Institutional Source Beutler Lab
Gene Symbol S100a9
Ensembl Gene ENSMUSG00000056071
Gene NameS100 calcium binding protein A9 (calgranulin B)
Synonyms60B8Ag, GAGB, Cagb, p14, MRP14, BEE22, L1Ag
MMRRC Submission 044116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5919 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90692632-90695721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90695188 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 33 (L33P)
Ref Sequence ENSEMBL: ENSMUSP00000112843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069960] [ENSMUST00000117167]
Predicted Effect probably damaging
Transcript: ENSMUST00000069960
AA Change: L33P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070842
Gene: ENSMUSG00000056071
AA Change: L33P

DomainStartEndE-ValueType
Pfam:S_100 9 51 6.7e-23 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117167
AA Change: L33P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112843
Gene: ENSMUSG00000056071
AA Change: L33P

DomainStartEndE-ValueType
Pfam:S_100 9 52 5.2e-24 PFAM
low complexity region 102 113 N/A INTRINSIC
Meta Mutation Damage Score 0.9438 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and altered expression of this protein is associated with the disease cystic fibrosis. This antimicrobial protein exhibits antifungal and antibacterial activity. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal immune physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T C 1: 151,915,498 D104G probably damaging Het
2610507B11Rik A T 11: 78,289,350 N2152I probably damaging Het
6030458C11Rik A T 15: 12,823,668 H40Q probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Adgrl1 G T 8: 83,932,610 D648Y probably damaging Het
Adgrl3 C A 5: 81,646,570 D547E probably benign Het
Aebp1 A T 11: 5,871,421 M607L probably benign Het
Angptl1 T C 1: 156,858,546 Y401H probably damaging Het
Arl4d A G 11: 101,667,136 T163A probably benign Het
Camk2b A G 11: 5,979,718 S331P probably damaging Het
Ccdc15 C T 9: 37,320,396 probably null Het
Ccdc38 A T 10: 93,578,838 I370F possibly damaging Het
Clstn1 A T 4: 149,635,246 H416L probably damaging Het
Col12a1 C T 9: 79,602,298 R3030H probably damaging Het
Cop1 T A 1: 159,319,724 V540E probably damaging Het
Crebbp C T 16: 4,108,127 R710H probably damaging Het
Dsel T C 1: 111,860,253 I851V probably benign Het
Esrp1 A G 4: 11,344,146 V642A probably damaging Het
Fam71e2 T C 7: 4,770,386 E144G possibly damaging Het
Fanci T C 7: 79,444,738 L1139P probably damaging Het
Fat1 T C 8: 45,026,873 probably null Het
Fsip2 A G 2: 82,992,609 N6229D possibly damaging Het
Gas2l3 G A 10: 89,417,055 R243W probably damaging Het
Gm7102 T C 19: 61,175,469 Y176C probably damaging Het
Gm8251 T C 1: 44,056,986 N1651D probably benign Het
Hectd1 G A 12: 51,769,072 R1406W probably damaging Het
Hecw2 T C 1: 53,937,090 H180R probably damaging Het
Ift172 T A 5: 31,260,662 Q1261L possibly damaging Het
Il17rd T C 14: 27,096,044 V230A probably damaging Het
Kif17 A T 4: 138,269,891 I42F probably damaging Het
Kif24 T C 4: 41,394,477 K799E possibly damaging Het
Lrp4 A T 2: 91,473,207 I84F probably damaging Het
Mroh7 T C 4: 106,694,312 probably null Het
Ms4a14 C A 19: 11,314,297 V13F possibly damaging Het
Muc2 T A 7: 141,694,928 V445D probably damaging Het
Muc6 A T 7: 141,641,570 M1317K possibly damaging Het
Myof T A 19: 38,024,370 D39V possibly damaging Het
Ndufaf1 A C 2: 119,660,228 V117G possibly damaging Het
Ndufs1 C G 1: 63,143,832 *728S probably null Het
Nup188 A T 2: 30,339,894 N1375Y probably damaging Het
Oasl1 T A 5: 114,928,270 I149N probably damaging Het
Olfr1504 A G 19: 13,887,845 Y122H probably damaging Het
Pelo C A 13: 115,089,309 C204F possibly damaging Het
Phf11d A C 14: 59,356,263 probably benign Het
Rars2 T C 4: 34,657,232 L526P probably damaging Het
Rrp1 A G 10: 78,405,588 L177P probably damaging Het
Slc4a7 A G 14: 14,791,092 D1045G probably benign Het
Slc9a3 C T 13: 74,158,740 T328I probably damaging Het
Spata6 A G 4: 111,779,208 D232G probably damaging Het
Taar6 A T 10: 23,985,270 I126N probably damaging Het
Tcrg-V6 A G 13: 19,190,612 Y16C probably benign Het
Tmeff2 C A 1: 51,132,152 C182* probably null Het
Tmem178 T A 17: 80,989,758 C190S probably damaging Het
Trerf1 T G 17: 47,323,282 noncoding transcript Het
Ubn2 A G 6: 38,491,488 I1046V possibly damaging Het
Vmn1r221 A T 13: 23,217,296 noncoding transcript Het
Vmn2r2 T C 3: 64,137,302 N141S probably benign Het
Zfp64 T A 2: 168,926,499 N398Y probably benign Het
Zfp787 T G 7: 6,132,835 Q139P probably damaging Het
Other mutations in S100a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:S100a9 APN 3 90692768 missense probably benign 0.23
IGL02343:S100a9 APN 3 90695224 missense probably damaging 1.00
R0748:S100a9 UTSW 3 90692891 missense possibly damaging 0.73
R4365:S100a9 UTSW 3 90692774 missense unknown
R5953:S100a9 UTSW 3 90692927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCACACATTGCAGATGTTC -3'
(R):5'- CCTAACAGTGGCCAGAGACTAG -3'

Sequencing Primer
(F):5'- AACTGAACCATTTCCTGACTCATGG -3'
(R):5'- ACTAGGTCAGGGAAGCTTGGTATC -3'
Posted On2017-02-28