Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Ptpn13'

46256

Institutional Source

Beutler Lab

Gene Symbol

Ptpn13

Ensembl Gene

ENSMUSG00000034573

Gene Name

protein tyrosine phosphatase, non-receptor type 13

Synonyms

PTPL1, Ptpri, PTP-BL

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.227) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103425192-103598303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103489765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 173 (V173A)

Ref Sequence

ENSEMBL: ENSMUSP00000048119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048957] [ENSMUST00000196014]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048957
AA Change: V173A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: V173A

Domain	Start	End	E-Value	Type
KIND	3	190	2.3e-80	SMART
Blast:B41	340	447	6e-34	BLAST
coiled coil region	460	487	N/A	INTRINSIC
B41	561	774	3.3e-68	SMART
FERM_C	780	869	3.2e-35	SMART
low complexity region	1049	1058	N/A	INTRINSIC
PDZ	1093	1170	7.6e-25	SMART
low complexity region	1224	1236	N/A	INTRINSIC
low complexity region	1309	1322	N/A	INTRINSIC
low complexity region	1331	1341	N/A	INTRINSIC
PDZ	1365	1442	1.7e-24	SMART
low complexity region	1450	1468	N/A	INTRINSIC
PDZ	1499	1579	3.5e-19	SMART
PDZ	1773	1845	1.2e-21	SMART
PDZ	1867	1942	1.6e-16	SMART
low complexity region	2123	2134	N/A	INTRINSIC
PTPc	2179	2436	6.9e-113	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000196014
AA Change: V173A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143571
Gene: ENSMUSG00000034573
AA Change: V173A

Domain	Start	End	E-Value	Type
KIND	3	190	2.3e-80	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199412

Meta Mutation Damage Score

0.2585

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Ptpn13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ptpn13	APN	5	103551058	missense	probably damaging	1.00
IGL00569:Ptpn13	APN	5	103591006	splice site	probably benign
IGL00764:Ptpn13	APN	5	103597718	missense	probably damaging	1.00
IGL00805:Ptpn13	APN	5	103554729	missense	probably benign	0.33
IGL00922:Ptpn13	APN	5	103588088	missense	probably damaging	1.00
IGL00959:Ptpn13	APN	5	103517571	critical splice donor site	probably null
IGL01090:Ptpn13	APN	5	103541314	missense	probably null	0.80
IGL01352:Ptpn13	APN	5	103486775	splice site	probably null
IGL01510:Ptpn13	APN	5	103562300	missense	probably damaging	1.00
IGL01515:Ptpn13	APN	5	103556113	missense	probably benign	0.06
IGL01896:Ptpn13	APN	5	103501523	missense	possibly damaging	0.78
IGL02094:Ptpn13	APN	5	103594617	missense	probably damaging	1.00
IGL02561:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02562:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02567:Ptpn13	APN	5	103562291	missense	probably damaging	1.00
IGL02604:Ptpn13	APN	5	103501903	missense	probably benign	0.01
IGL02679:Ptpn13	APN	5	103569454	missense	possibly damaging	0.55
IGL02981:Ptpn13	APN	5	103528804	missense	probably damaging	1.00
IGL03131:Ptpn13	APN	5	103517559	missense	probably benign
IGL03136:Ptpn13	APN	5	103543463	missense	possibly damaging	0.49
IGL03163:Ptpn13	APN	5	103591346	missense	probably damaging	1.00
IGL03271:Ptpn13	APN	5	103462148	missense	probably damaging	1.00
IGL03297:Ptpn13	APN	5	103541077	missense	probably benign	0.13
IGL03328:Ptpn13	APN	5	103516348	missense	probably benign	0.00
IGL03343:Ptpn13	APN	5	103554950	missense	possibly damaging	0.88
IGL02835:Ptpn13	UTSW	5	103560025	missense	probably damaging	0.98
P0021:Ptpn13	UTSW	5	103528820	missense	probably benign	0.39
R0017:Ptpn13	UTSW	5	103486772	critical splice donor site	probably null
R0090:Ptpn13	UTSW	5	103569503	missense	probably damaging	1.00
R0111:Ptpn13	UTSW	5	103580763	splice site	probably benign
R0183:Ptpn13	UTSW	5	103516408	missense	probably benign	0.00
R0230:Ptpn13	UTSW	5	103527131	missense	probably damaging	1.00
R0302:Ptpn13	UTSW	5	103565225	missense	probably benign
R0360:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0364:Ptpn13	UTSW	5	103533348	missense	probably damaging	1.00
R0388:Ptpn13	UTSW	5	103555062	missense	probably benign	0.31
R0504:Ptpn13	UTSW	5	103501496	missense	possibly damaging	0.92
R0558:Ptpn13	UTSW	5	103529717	missense	probably damaging	0.99
R0562:Ptpn13	UTSW	5	103516425	critical splice donor site	probably null
R0609:Ptpn13	UTSW	5	103556145	missense	probably benign
R0669:Ptpn13	UTSW	5	103556109	missense	probably benign
R0739:Ptpn13	UTSW	5	103575132	missense	probably benign
R1006:Ptpn13	UTSW	5	103586789	missense	probably benign	0.04
R1164:Ptpn13	UTSW	5	103489773	missense	probably damaging	1.00
R1274:Ptpn13	UTSW	5	103550260	missense	probably damaging	0.98
R1501:Ptpn13	UTSW	5	103516364	missense	probably benign	0.01
R1529:Ptpn13	UTSW	5	103564132	missense	probably benign	0.00
R1533:Ptpn13	UTSW	5	103556178	nonsense	probably null
R1613:Ptpn13	UTSW	5	103536871	missense	possibly damaging	0.89
R1616:Ptpn13	UTSW	5	103565237	missense	possibly damaging	0.49
R1830:Ptpn13	UTSW	5	103543459	missense	probably benign	0.00
R1892:Ptpn13	UTSW	5	103501679	missense	possibly damaging	0.92
R1907:Ptpn13	UTSW	5	103580709	missense	probably null	0.45
R2143:Ptpn13	UTSW	5	103556133	missense	probably benign
R2145:Ptpn13	UTSW	5	103556133	missense	probably benign
R2151:Ptpn13	UTSW	5	103525785	missense	probably damaging	1.00
R2180:Ptpn13	UTSW	5	103569558	missense	probably damaging	1.00
R2264:Ptpn13	UTSW	5	103489661	missense	possibly damaging	0.96
R2313:Ptpn13	UTSW	5	103564161	missense	probably damaging	1.00
R3522:Ptpn13	UTSW	5	103589854	splice site	probably benign
R3773:Ptpn13	UTSW	5	103477121	missense	probably damaging	1.00
R3924:Ptpn13	UTSW	5	103550741	splice site	probably benign
R4289:Ptpn13	UTSW	5	103533285	missense	probably damaging	1.00
R4348:Ptpn13	UTSW	5	103569726	missense	probably damaging	1.00
R4385:Ptpn13	UTSW	5	103533407	splice site	probably null
R4526:Ptpn13	UTSW	5	103501469	missense	probably benign	0.32
R4557:Ptpn13	UTSW	5	103541110	missense	probably damaging	1.00
R4596:Ptpn13	UTSW	5	103523692	missense	probably benign	0.06
R4632:Ptpn13	UTSW	5	103569860	missense	possibly damaging	0.46
R4727:Ptpn13	UTSW	5	103569855	missense	probably benign
R4780:Ptpn13	UTSW	5	103586773	missense	probably benign	0.04
R4793:Ptpn13	UTSW	5	103582778	critical splice donor site	probably null
R4812:Ptpn13	UTSW	5	103523615	missense	probably benign	0.00
R4939:Ptpn13	UTSW	5	103517469	splice site	probably null
R4951:Ptpn13	UTSW	5	103588046	missense	probably benign	0.00
R5052:Ptpn13	UTSW	5	103561980	missense	probably damaging	1.00
R5148:Ptpn13	UTSW	5	103492232	missense	probably damaging	1.00
R5309:Ptpn13	UTSW	5	103541053	missense	probably damaging	1.00
R5521:Ptpn13	UTSW	5	103501428	missense	probably benign	0.03
R5545:Ptpn13	UTSW	5	103561964	missense	probably damaging	1.00
R5696:Ptpn13	UTSW	5	103554759	missense	probably benign	0.20
R5735:Ptpn13	UTSW	5	103554820	missense	probably benign	0.03
R5815:Ptpn13	UTSW	5	103597690	splice site	probably null
R5876:Ptpn13	UTSW	5	103476960	missense	probably damaging	1.00
R5878:Ptpn13	UTSW	5	103477118	missense	possibly damaging	0.89
R6366:Ptpn13	UTSW	5	103551053	missense	probably damaging	1.00
R6455:Ptpn13	UTSW	5	103541284	missense	probably benign	0.00
R6492:Ptpn13	UTSW	5	103501612	missense	probably benign	0.02
R6709:Ptpn13	UTSW	5	103586756	missense	probably benign	0.18
R6759:Ptpn13	UTSW	5	103565255	missense	possibly damaging	0.49
R6944:Ptpn13	UTSW	5	103476991	missense	probably null	1.00
R7079:Ptpn13	UTSW	5	103501886	missense	probably benign	0.00
R7253:Ptpn13	UTSW	5	103565284	missense	possibly damaging	0.68
R7254:Ptpn13	UTSW	5	103594636	missense	probably damaging	1.00
R7391:Ptpn13	UTSW	5	103540981	missense	probably damaging	1.00
R7451:Ptpn13	UTSW	5	103527095	missense	probably benign	0.16
R7614:Ptpn13	UTSW	5	103501465	missense	probably benign	0.13
R7652:Ptpn13	UTSW	5	103529712	missense	probably benign	0.12
R7655:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7656:Ptpn13	UTSW	5	103540983	missense	probably benign	0.00
R7683:Ptpn13	UTSW	5	103565152	missense	probably benign	0.01
R7734:Ptpn13	UTSW	5	103561962	missense	probably damaging	1.00
R7794:Ptpn13	UTSW	5	103492224	missense	probably benign	0.06
R7834:Ptpn13	UTSW	5	103462148	missense	probably damaging	1.00
R7911:Ptpn13	UTSW	5	103541058	missense	probably damaging	1.00
R8010:Ptpn13	UTSW	5	103559937	nonsense	probably null
R8308:Ptpn13	UTSW	5	103540972	missense	probably damaging	0.99
R8493:Ptpn13	UTSW	5	103564165	missense	probably damaging	1.00
R8493:Ptpn13	UTSW	5	103569805	missense	probably benign	0.01
R8507:Ptpn13	UTSW	5	103557949	missense	probably damaging	1.00
R8556:Ptpn13	UTSW	5	103559172	missense	probably damaging	1.00
R8924:Ptpn13	UTSW	5	103591235	missense	probably damaging	1.00
R8933:Ptpn13	UTSW	5	103579805	missense	probably benign	0.00
R8958:Ptpn13	UTSW	5	103551107	missense	probably benign	0.15
R8975:Ptpn13	UTSW	5	103501400	missense	probably benign	0.32
R9080:Ptpn13	UTSW	5	103489628	missense	probably damaging	0.99
R9091:Ptpn13	UTSW	5	103501869	missense	possibly damaging	0.67
R9219:Ptpn13	UTSW	5	103597766	missense	probably benign	0.16
R9270:Ptpn13	UTSW	5	103501869	missense	possibly damaging	0.67
RF017:Ptpn13	UTSW	5	103593580	missense	probably benign	0.45
Z1177:Ptpn13	UTSW	5	103569556	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATCTCCTGTGAACATTCGCTGTG -3'
(R):5'- TCAAGTGTCAGGAAGCAGCAGACC -3'

Sequencing Primer
(F):5'- GTTCCTGAGATCCCATTAAGGC -3'
(R):5'- CTGAAATCACTCTGGGTGAATGC -3'

Posted On

2013-06-11