Incidental Mutation 'R5919:Fanci'
ID462564
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene NameFanconi anemia, complementation group I
Synonyms
MMRRC Submission 044116-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R5919 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79391929-79450264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79444738 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1139 (L1139P)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000132091] [ENSMUST00000139290] [ENSMUST00000149444]
PDB Structure
Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036865
AA Change: L1139P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: L1139P

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073889
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117227
AA Change: L1134P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112383
Gene: ENSMUSG00000039187
AA Change: L1134P

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 4.5e-29 PFAM
Pfam:FANCI_S1 60 281 2.9e-80 PFAM
Pfam:FANCI_HD1 284 371 5.2e-37 PFAM
Pfam:FANCI_S2 377 541 2.8e-56 PFAM
Pfam:FANCI_HD2 551 786 2.8e-99 PFAM
Pfam:FANCI_S3 803 1029 1.3e-90 PFAM
Pfam:FANCI_S4 1039 1292 1.4e-106 PFAM
low complexity region 1294 1302 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139290
SMART Domains Protein: ENSMUSP00000144035
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 1 69 2e-41 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154403
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect unknown
Transcript: ENSMUST00000206121
AA Change: W107R
Meta Mutation Damage Score 0.9422 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T C 1: 151,915,498 D104G probably damaging Het
2610507B11Rik A T 11: 78,289,350 N2152I probably damaging Het
6030458C11Rik A T 15: 12,823,668 H40Q probably damaging Het
Abcc3 A G 11: 94,357,306 V1156A possibly damaging Het
Adgrl1 G T 8: 83,932,610 D648Y probably damaging Het
Adgrl3 C A 5: 81,646,570 D547E probably benign Het
Aebp1 A T 11: 5,871,421 M607L probably benign Het
Angptl1 T C 1: 156,858,546 Y401H probably damaging Het
Arl4d A G 11: 101,667,136 T163A probably benign Het
Camk2b A G 11: 5,979,718 S331P probably damaging Het
Ccdc15 C T 9: 37,320,396 probably null Het
Ccdc38 A T 10: 93,578,838 I370F possibly damaging Het
Clstn1 A T 4: 149,635,246 H416L probably damaging Het
Col12a1 C T 9: 79,602,298 R3030H probably damaging Het
Cop1 T A 1: 159,319,724 V540E probably damaging Het
Crebbp C T 16: 4,108,127 R710H probably damaging Het
Dsel T C 1: 111,860,253 I851V probably benign Het
Esrp1 A G 4: 11,344,146 V642A probably damaging Het
Fam71e2 T C 7: 4,770,386 E144G possibly damaging Het
Fat1 T C 8: 45,026,873 probably null Het
Fsip2 A G 2: 82,992,609 N6229D possibly damaging Het
Gas2l3 G A 10: 89,417,055 R243W probably damaging Het
Gm7102 T C 19: 61,175,469 Y176C probably damaging Het
Gm8251 T C 1: 44,056,986 N1651D probably benign Het
Hectd1 G A 12: 51,769,072 R1406W probably damaging Het
Hecw2 T C 1: 53,937,090 H180R probably damaging Het
Ift172 T A 5: 31,260,662 Q1261L possibly damaging Het
Il17rd T C 14: 27,096,044 V230A probably damaging Het
Kif17 A T 4: 138,269,891 I42F probably damaging Het
Kif24 T C 4: 41,394,477 K799E possibly damaging Het
Lrp4 A T 2: 91,473,207 I84F probably damaging Het
Mroh7 T C 4: 106,694,312 probably null Het
Ms4a14 C A 19: 11,314,297 V13F possibly damaging Het
Muc2 T A 7: 141,694,928 V445D probably damaging Het
Muc6 A T 7: 141,641,570 M1317K possibly damaging Het
Myof T A 19: 38,024,370 D39V possibly damaging Het
Ndufaf1 A C 2: 119,660,228 V117G possibly damaging Het
Ndufs1 C G 1: 63,143,832 *728S probably null Het
Nup188 A T 2: 30,339,894 N1375Y probably damaging Het
Oasl1 T A 5: 114,928,270 I149N probably damaging Het
Olfr1504 A G 19: 13,887,845 Y122H probably damaging Het
Pelo C A 13: 115,089,309 C204F possibly damaging Het
Phf11d A C 14: 59,356,263 probably benign Het
Rars2 T C 4: 34,657,232 L526P probably damaging Het
Rrp1 A G 10: 78,405,588 L177P probably damaging Het
S100a9 A G 3: 90,695,188 L33P probably damaging Het
Slc4a7 A G 14: 14,791,092 D1045G probably benign Het
Slc9a3 C T 13: 74,158,740 T328I probably damaging Het
Spata6 A G 4: 111,779,208 D232G probably damaging Het
Taar6 A T 10: 23,985,270 I126N probably damaging Het
Tcrg-V6 A G 13: 19,190,612 Y16C probably benign Het
Tmeff2 C A 1: 51,132,152 C182* probably null Het
Tmem178 T A 17: 80,989,758 C190S probably damaging Het
Trerf1 T G 17: 47,323,282 noncoding transcript Het
Ubn2 A G 6: 38,491,488 I1046V possibly damaging Het
Vmn1r221 A T 13: 23,217,296 noncoding transcript Het
Vmn2r2 T C 3: 64,137,302 N141S probably benign Het
Zfp64 T A 2: 168,926,499 N398Y probably benign Het
Zfp787 T G 7: 6,132,835 Q139P probably damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79412700 missense probably damaging 1.00
IGL00718:Fanci APN 7 79444174 missense possibly damaging 0.92
IGL00764:Fanci APN 7 79395912 start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79449177 missense probably benign 0.01
IGL02338:Fanci APN 7 79433531 nonsense probably null
IGL02428:Fanci APN 7 79444516 intron probably benign
IGL03029:Fanci APN 7 79443999 missense probably benign 0.00
BB005:Fanci UTSW 7 79444711 missense probably benign
BB015:Fanci UTSW 7 79444711 missense probably benign
P0023:Fanci UTSW 7 79402300 missense probably benign 0.00
P0047:Fanci UTSW 7 79444044 missense probably damaging 1.00
R0310:Fanci UTSW 7 79407417 splice site probably benign
R0388:Fanci UTSW 7 79439630 missense probably benign
R0506:Fanci UTSW 7 79432178 missense probably benign 0.29
R0570:Fanci UTSW 7 79443963 missense probably damaging 1.00
R0631:Fanci UTSW 7 79406205 missense probably damaging 1.00
R0746:Fanci UTSW 7 79439681 missense probably damaging 0.99
R0981:Fanci UTSW 7 79405166 missense probably benign 0.01
R1559:Fanci UTSW 7 79433193 missense probably damaging 1.00
R1656:Fanci UTSW 7 79405188 splice site probably benign
R1748:Fanci UTSW 7 79430488 missense probably damaging 1.00
R1815:Fanci UTSW 7 79438308 missense probably damaging 1.00
R2164:Fanci UTSW 7 79395995 missense probably benign 0.22
R3508:Fanci UTSW 7 79433472 missense probably benign 0.01
R3908:Fanci UTSW 7 79433509 missense possibly damaging 0.91
R4036:Fanci UTSW 7 79444822 missense probably damaging 1.00
R4066:Fanci UTSW 7 79412757 critical splice donor site probably null
R4633:Fanci UTSW 7 79427242 missense probably damaging 1.00
R4651:Fanci UTSW 7 79435256 missense possibly damaging 0.74
R4993:Fanci UTSW 7 79435378 makesense probably null
R5341:Fanci UTSW 7 79406178 missense probably damaging 1.00
R5806:Fanci UTSW 7 79448848 missense probably damaging 0.97
R5898:Fanci UTSW 7 79433321 missense probably benign
R5960:Fanci UTSW 7 79443762 missense probably damaging 1.00
R6367:Fanci UTSW 7 79426195 missense probably damaging 0.99
R6436:Fanci UTSW 7 79440698 missense probably benign 0.03
R6468:Fanci UTSW 7 79417939 missense probably benign 0.10
R6508:Fanci UTSW 7 79443768 missense probably damaging 0.99
R6886:Fanci UTSW 7 79420342 missense possibly damaging 0.81
R7554:Fanci UTSW 7 79412752 missense probably damaging 0.99
R7588:Fanci UTSW 7 79434269 missense possibly damaging 0.81
R7644:Fanci UTSW 7 79444471 nonsense probably null
R7697:Fanci UTSW 7 79406292 critical splice donor site probably null
R7732:Fanci UTSW 7 79412652 missense possibly damaging 0.65
R7928:Fanci UTSW 7 79444711 missense probably benign
R8355:Fanci UTSW 7 79435281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCACCAAAATGTCAGTG -3'
(R):5'- AGAGGCACTGTGAATCTGGC -3'

Sequencing Primer
(F):5'- ATGTCAGTGCGAACCATTGC -3'
(R):5'- ATCTGGCCTGTGGGAACAG -3'
Posted On2017-02-28