Mutagenetix > Incidental Mutation

Incidental Mutation 'R0568:Pitpnm2'

46257

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm2

Ensembl Gene

ENSMUSG00000029406

Gene Name

phosphatidylinositol transfer protein, membrane-associated 2

Synonyms

NIR3, RDGBA2, Rdgb2

MMRRC Submission

038759-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0568 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

124118690-124249760 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 124140517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124740 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161644] [ENSMUST00000161938] [ENSMUST00000162812]

AlphaFold

Q6ZPQ6

Predicted Effect

probably benign
Transcript: ENSMUST00000086123

SMART Domains

Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159677

SMART Domains

Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-130	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161273

SMART Domains

Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	3.2e-129	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	945	7.5e-100	SMART
LNS2	1090	1221	3.1e-59	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161530

Predicted Effect

probably benign
Transcript: ENSMUST00000161644

Predicted Effect

probably benign
Transcript: ENSMUST00000161938

SMART Domains

Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	251	7.5e-116	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
Blast:DDHD	422	670	2e-65	BLAST
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	949	8.37e-104	SMART
LNS2	1094	1225	3.22e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162812

SMART Domains

Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	253	6.1e-132	PFAM
low complexity region	298	319	N/A	INTRINSIC
low complexity region	333	344	N/A	INTRINSIC
low complexity region	507	515	N/A	INTRINSIC
Blast:DDHD	548	570	6e-7	BLAST
low complexity region	571	589	N/A	INTRINSIC
low complexity region	608	630	N/A	INTRINSIC
low complexity region	682	689	N/A	INTRINSIC
DDHD	701	895	1.66e-98	SMART
LNS2	1040	1171	3.22e-55	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Gtf2ird2	G	T	5: 134,211,242	E302*	probably null	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Pitpnm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Pitpnm2	APN	5	124121663	unclassified	probably benign
IGL01660:Pitpnm2	APN	5	124123194	missense	probably damaging	1.00
IGL02328:Pitpnm2	APN	5	124121414	missense	probably damaging	0.99
IGL02340:Pitpnm2	APN	5	124130613	missense	probably damaging	1.00
IGL02399:Pitpnm2	APN	5	124140758	splice site	probably benign
IGL02719:Pitpnm2	APN	5	124140602	missense	probably damaging	1.00
IGL03053:Pitpnm2	APN	5	124143601	missense	probably damaging	1.00
IGL03083:Pitpnm2	APN	5	124133382	missense	possibly damaging	0.92
PIT4131001:Pitpnm2	UTSW	5	124131115	missense	probably benign	0.01
R0058:Pitpnm2	UTSW	5	124124030	missense	probably damaging	1.00
R0437:Pitpnm2	UTSW	5	124131089	splice site	probably benign
R0530:Pitpnm2	UTSW	5	124131201	missense	probably damaging	1.00
R0926:Pitpnm2	UTSW	5	124131209	missense	probably benign	0.10
R1625:Pitpnm2	UTSW	5	124133433	missense	probably benign	0.05
R2008:Pitpnm2	UTSW	5	124152621	start codon destroyed	probably damaging	0.99
R2120:Pitpnm2	UTSW	5	124127269	missense	probably damaging	1.00
R2354:Pitpnm2	UTSW	5	124122919	missense	probably damaging	0.99
R2448:Pitpnm2	UTSW	5	124123994	missense	probably damaging	1.00
R2509:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2510:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2511:Pitpnm2	UTSW	5	124136326	missense	probably damaging	0.99
R2520:Pitpnm2	UTSW	5	124129401	missense	probably damaging	0.96
R2860:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R2861:Pitpnm2	UTSW	5	124121437	missense	probably damaging	1.00
R4407:Pitpnm2	UTSW	5	124152615	missense	possibly damaging	0.57
R4417:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R4426:Pitpnm2	UTSW	5	124142123	missense	probably benign	0.32
R4458:Pitpnm2	UTSW	5	124121376	missense	probably benign	0.00
R4610:Pitpnm2	UTSW	5	124125371	missense	probably damaging	0.99
R4786:Pitpnm2	UTSW	5	124121743	nonsense	probably null
R4903:Pitpnm2	UTSW	5	124152605	missense	probably damaging	1.00
R5151:Pitpnm2	UTSW	5	124136386	missense	probably damaging	1.00
R5315:Pitpnm2	UTSW	5	124121933	missense	probably benign	0.18
R5592:Pitpnm2	UTSW	5	124142149	missense	probably damaging	1.00
R5792:Pitpnm2	UTSW	5	124130321	nonsense	probably null
R6846:Pitpnm2	UTSW	5	124131171	missense	probably benign	0.00
R6983:Pitpnm2	UTSW	5	124133406	missense	probably damaging	1.00
R7096:Pitpnm2	UTSW	5	124129261	missense	possibly damaging	0.69
R7188:Pitpnm2	UTSW	5	124121303	missense	probably benign	0.31
R7203:Pitpnm2	UTSW	5	124121459	missense	probably damaging	0.96
R7237:Pitpnm2	UTSW	5	124125297	critical splice donor site	probably null
R7257:Pitpnm2	UTSW	5	124125356	missense	possibly damaging	0.88
R7622:Pitpnm2	UTSW	5	124122027	missense	probably benign	0.39
R7677:Pitpnm2	UTSW	5	124123569	missense	probably damaging	1.00
R7736:Pitpnm2	UTSW	5	124123030	missense	possibly damaging	0.47
R7745:Pitpnm2	UTSW	5	124128705	missense	probably benign	0.19
R8041:Pitpnm2	UTSW	5	124121456	missense	probably damaging	1.00
R9070:Pitpnm2	UTSW	5	124121312	missense	probably damaging	1.00
R9218:Pitpnm2	UTSW	5	124127281	missense	probably damaging	0.97
R9423:Pitpnm2	UTSW	5	124133406	missense	probably benign	0.05
R9438:Pitpnm2	UTSW	5	124131279	missense	probably damaging	0.99
R9439:Pitpnm2	UTSW	5	124136126	missense	probably damaging	1.00
R9439:Pitpnm2	UTSW	5	124140596	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGGCATACTGGTCCTGGATGG -3'
(R):5'- TGTTCCAGTCAGTCAAGACTTGCCG -3'

Sequencing Primer
(F):5'- gcttttgctctttgcctacttg -3'
(R):5'- CGGGGACCTCTTTCTGAAAAC -3'

Posted On

2013-06-11