Mutagenetix > Incidental Mutations

Incidental Mutation 'R0568:Gtf2ird2'

46258

Institutional Source

Beutler Lab

Gene Symbol

Gtf2ird2

Ensembl Gene

ENSMUSG00000015942

Gene Name

GTF2I repeat domain containing 2

Synonyms

1700012P16Rik

MMRRC Submission

038759-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R0568 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134184019-134224355 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 134211242 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 302 (E302*)

Ref Sequence

ENSEMBL: ENSMUSP00000016086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016086] [ENSMUST00000123941] [ENSMUST00000152587]

Predicted Effect

probably null
Transcript: ENSMUST00000016086
AA Change: E302*

SMART Domains

Protein: ENSMUSP00000016086
Gene: ENSMUSG00000015942
AA Change: E302*

Domain	Start	End	E-Value	Type
Pfam:GTF2I	104	178	6.1e-31	PFAM
Pfam:GTF2I	328	402	1.6e-25	PFAM
Blast:Tryp_SPc	436	491	4e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000123941

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128842

Predicted Effect

probably benign
Transcript: ENSMUST00000135588

Predicted Effect

probably benign
Transcript: ENSMUST00000152587

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.4%

Validation Efficiency

100% (38/38)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810043G02Rik	C	T	10: 77,983,038	T181I	possibly damaging	Het
1810043G02Rik	A	T	10: 77,984,547	*250C	probably null	Het
Acnat1	G	A	4: 49,451,003	T36I	possibly damaging	Het
Adamts20	T	C	15: 94,291,713		probably benign	Het
Adamtsl1	T	C	4: 86,418,552	L1558S	probably damaging	Het
Ap3b2	A	G	7: 81,464,629		probably null	Het
Bag2	T	C	1: 33,746,978	M88V	probably benign	Het
Brms1l	A	G	12: 55,861,388		probably null	Het
C8b	A	G	4: 104,793,380	I462V	probably benign	Het
Cnpy4	A	G	5: 138,192,577	E167G	probably damaging	Het
Copa	T	C	1: 172,112,137	V624A	possibly damaging	Het
Gm4553	G	T	7: 142,165,620	P24T	unknown	Het
Gna12	A	G	5: 140,760,883	V269A	possibly damaging	Het
Hmcn2	C	A	2: 31,415,236	S3140R	probably benign	Het
Hspa4	A	G	11: 53,262,876		probably benign	Het
Hspbp1	A	T	7: 4,684,432	L60*	probably null	Het
Lats1	A	T	10: 7,712,528	I970F	possibly damaging	Het
Lipo3	T	C	19: 33,582,042		probably benign	Het
Lrrc3	T	A	10: 77,901,585	R6W	probably damaging	Het
Lxn	C	T	3: 67,461,002	A143T	probably damaging	Het
Mga	T	C	2: 119,935,422	I1390T	probably damaging	Het
Ncapg2	T	A	12: 116,423,215	I286N	probably damaging	Het
Olfr1212	T	A	2: 88,959,043	Y192*	probably null	Het
Papd4	A	G	13: 93,154,992	S381P	probably benign	Het
Pitpnm2	A	G	5: 124,140,517		probably benign	Het
Plxna2	T	C	1: 194,751,386	V581A	probably benign	Het
Polr3d	A	T	14: 70,439,519	H378Q	possibly damaging	Het
Ptpn13	T	C	5: 103,489,765	V173A	probably damaging	Het
Rbpms2	ACTGCTGCTGCTGCTGC	ACTGCTGCTGCTGCTGCTGC	9: 65,651,666		probably benign	Het
Smc4	T	C	3: 69,022,461		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Syngr3	C	T	17: 24,686,581	A140T	probably benign	Het
Tprn	T	C	2: 25,264,321	V545A	probably damaging	Het
Trim66	T	C	7: 109,460,695	H828R	probably benign	Het
Ugt2b5	G	A	5: 87,137,365		probably benign	Het
Vps9d1	A	G	8: 123,246,748	V432A	probably damaging	Het
Zswim9	A	T	7: 13,261,026	D401E	probably damaging	Het

Other mutations in Gtf2ird2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01143:Gtf2ird2	APN	5	134196553	missense	possibly damaging	0.93
IGL01295:Gtf2ird2	APN	5	134192764	missense	probably damaging	1.00
IGL01603:Gtf2ird2	APN	5	134202288	splice site	probably benign
IGL01824:Gtf2ird2	APN	5	134197282	splice site	probably benign
IGL02469:Gtf2ird2	APN	5	134191249	missense	probably damaging	1.00
IGL02525:Gtf2ird2	APN	5	134216477	missense	probably benign	0.03
IGL02567:Gtf2ird2	APN	5	134213048	unclassified	probably benign
IGL02750:Gtf2ird2	APN	5	134216889	missense	probably damaging	0.99
IGL02992:Gtf2ird2	APN	5	134217614	missense	possibly damaging	0.79
IGL03000:Gtf2ird2	APN	5	134194906	missense	probably benign	0.45
IGL03114:Gtf2ird2	APN	5	134216910	splice site	probably null
IGL03180:Gtf2ird2	APN	5	134191248	missense	probably damaging	1.00
R0077:Gtf2ird2	UTSW	5	134214083	missense	probably damaging	1.00
R0100:Gtf2ird2	UTSW	5	134217015	missense	probably damaging	0.97
R0100:Gtf2ird2	UTSW	5	134217015	missense	probably damaging	0.97
R0344:Gtf2ird2	UTSW	5	134191249	missense	probably damaging	1.00
R0570:Gtf2ird2	UTSW	5	134208944	critical splice donor site	probably null
R0730:Gtf2ird2	UTSW	5	134192758	nonsense	probably null
R0826:Gtf2ird2	UTSW	5	134216955	missense	probably damaging	1.00
R1707:Gtf2ird2	UTSW	5	134216987	missense	probably damaging	1.00
R1710:Gtf2ird2	UTSW	5	134211240	missense	probably benign	0.26
R2064:Gtf2ird2	UTSW	5	134216498	nonsense	probably null
R2284:Gtf2ird2	UTSW	5	134217183	missense	probably benign	0.05
R2375:Gtf2ird2	UTSW	5	134217135	missense	probably benign	0.20
R3104:Gtf2ird2	UTSW	5	134208915	missense	probably benign	0.42
R4436:Gtf2ird2	UTSW	5	134194969	missense	possibly damaging	0.95
R4647:Gtf2ird2	UTSW	5	134216192	missense	probably damaging	1.00
R4708:Gtf2ird2	UTSW	5	134216298	missense	probably damaging	0.99
R4775:Gtf2ird2	UTSW	5	134214128	missense	probably benign	0.01
R4999:Gtf2ird2	UTSW	5	134217464	missense	probably damaging	0.97
R5011:Gtf2ird2	UTSW	5	134216982	missense	possibly damaging	0.90
R5036:Gtf2ird2	UTSW	5	134217507	missense	probably damaging	1.00
R5261:Gtf2ird2	UTSW	5	134216219	missense	probably benign	0.00
R5379:Gtf2ird2	UTSW	5	134217468	missense	probably benign
R5921:Gtf2ird2	UTSW	5	134217584	missense	probably damaging	1.00
R6180:Gtf2ird2	UTSW	5	134216547	missense	probably damaging	1.00
R6483:Gtf2ird2	UTSW	5	134211225	missense	probably benign	0.00
R7355:Gtf2ird2	UTSW	5	134216649	missense	probably benign	0.24
R7475:Gtf2ird2	UTSW	5	134201426	missense	possibly damaging	0.47
R7566:Gtf2ird2	UTSW	5	134214006	missense	probably damaging	1.00
R8021:Gtf2ird2	UTSW	5	134203334	missense	probably benign

Predicted Primers

Posted On

2013-06-11